Forgot your password?
typodupeerror
Biotech Crime Science

DNA Fog Helps Identify Trespassers, Thieves, and Brigands 129

Zothecula writes "Applied DNA Sciences (ADNAS) has developed a new approach to solve crimes using DNA tagging. The difference is that instead of tagging the objects being stolen, the company's system tags the perpetrator with DNA. While this has been tried before by applying the DNA to a fleeing criminal with a gun, ADNAS has adopted a more subtle approach."
This discussion has been archived. No new comments can be posted.

DNA Fog Helps Identify Trespassers, Thieves, and Brigands

Comments Filter:
  • Why not fog the warehouse with cold viruses that give you flourescent green boogers?

  • ...that's a spray, and the smell is fairly easy to follow.

    Seriously, this sounds pretty interesting, and scary all at the same time. It has the potential to last years, but it appears that a Police swab would be necessary. Why not make it so it's luminescent thus allowing a special light to be used to detect the DNA? This would prevent the need of the swab and the refusal of a perpetrator from providing the sample.

    Just a thought.

    • It wouldn't help you track the brigand to tag them with just DNA, you would have to pick them up for something else or have enough evidence for probable cause before you could even swab them or their belongings. I am however sure a police dog could be trained to track a some kind of oil based scent that would be really hard to remove like a skunk scent. Then everything in of your store/warehouse/factory/home would be tagged with it as well so I don't think that would work either.

      • by icebike ( 68054 ) on Monday June 17, 2013 @03:04PM (#44032475)

        Ah, at last someone gets to the crux of the matter.

        You still have to find the perp via some other means.

        Then take DNA samples and process those. But wait, you also have to sequester every cop who visited the crime scene and not let them touch any evidence for weeks on end. And not just the evidence from one crime scene, but all the crime scenes using this technology. Once the cops set foot on the premises they too will be tagged. As well as their wives and co-workers that come in contact with their uniforms, objects they handled, and any perps they happen to apprehend.

        Your average burglary detective would spread the DNA from several recent robberies to every suspect they hauled in. Would do wonders for their arrest rates. *cough*.

        So the DNA taging system builds a web of uselessness around itself, which spreads wider daily, while at the same time provides not a single additional clue to help you catch the thief.

        And I don't believe that bit about being hard to wash off either. After all, if you can sample it by simply using a swab, how tightly can it be bound?

        • Shortly after they had new security cameras professionally installed at work, I called the site director over and had him watch the dvr screen. I told him to watch me walk out of the building and back in... I walked out of the building normally and off camera then walked back in at angles I knew the cameras where missing when I got back to the office he says "I thought you were pulling a prank and just went to lunch cause I didn't see you coming back".

          He ended up calling them back to fix it. I think the bui

    • by pepty ( 1976012 )
      fluorescent dyes are great, but they would also alert the criminals that they need to wash up. (blacklight flashlights cost less than $10 these days). DNA is great, but easily destroyed by 5% bleach. So long as the criminals throw away or bleach everything they brought with them (including themselves and the loot) this system is beatable.

      I think the police would ban the use of thiols at crime scenes after their first investigation. "You want me to go IN THERE and bag evidence? Fuck that, I'm on sick leave

  • Because this could NEVER-EVER be misused.

    • Comment removed (Score:4, Insightful)

      by account_deleted ( 4530225 ) on Monday June 17, 2013 @01:14PM (#44031233)
      Comment removed based on user account deletion
      • by icebike ( 68054 )

        Yup, it's not like the clothing could be washed & dried in a public laundromat and the next fifty people to use it become suspects.

        Well the detectives investigating the crime scene will pick up quite a load of this DNA too. So any random person they choose to get off the streets and puff up their arrest record will be tagged as the detectives grab them and cuff them. And sure enough, the tags will match.

    • by tloh ( 451585 )

      Maybe the article was badly written, but at face value, it seems like a dumb idea to begin with. DNA molecules of any practical size are much to large to be suspended in the air for long. Any surface that is non-sterile is filled with nucleases released by microorganisms and endogenous enzymes from the human body that will quickly degrade your DNA beyond recognition. It would be as if those dye packs being used by banks are water soluble. All a criminal needs to do is do laundry and take a shower to eli

      • Plus, the security guard who responds to the alarm will probably get the DNA all over themselves as well. And security people are always on the first list of suspects, so every job will appear to be an inside job, OR the security people will be free to steal whatever they want, since they have an alibi for having the DNA on them.

        Until the security guards learn to just not respond to alarms. Which means the cops are free to steal as much as they want, since THEY will be the ones to have the DNA all over th

      • Any surface that is non-sterile is filled with nucleases released by microorganisms and endogenous enzymes from the human body that will quickly degrade your DNA beyond recognition.

        "degrade" , yes ; "beyond recognition", no.

        Forensic scientists and archaeologists - in fact, almost anyone who works with DNA and isn't a medic - are well used to working with contaminated, multiple-source DNA samples. It does make the job harder (which is why in the real world you'll only hear DNA evidence presented as probabil

        • by tloh ( 451585 )

          I would defer on matters pertaining to the specific robustness of forensic analysis to others with more experience in the particular field. However, as someone who has an annoying number of experiments fail due to contamination and other mysteries of the often fragile and fickle nature of DNA/RNA, I wonder why someone would bother *intentionally* use it to construct a tool in this manner. If you were to design a bio-metric ID tagging system from the ground up, you don't have to limit yourself to the means

          • Original scheme :
            • Make DNA tags.
            • Apply DNA tags

            Your revised scheme :

            • Make DNA tags.
            • Provide protective coating to tags, as sets of tags.
            • Apply DNA tags

            Depending on how you do your accounting, and the relative costs of your materials (declining as production volumes increase) versus your labour (may decline if you can move it down from skilled lab workers to MacDonald's burger-flipping rejects), you've increased your costs by between 30% and 50%.

            • by tloh ( 451585 )

              It doesn't necessarily have to be more costly. (Or perhaps trivially so) On the other hand the additional cost could be value added features that enhance the usefulness of the tags. The tags can be engineered and packaged to any degree that can be implemented with current technology. Having thought about this now for a few days, I think one very viable option is to maintain the tags *inside* a bacterial host as part of its chromosome or as discreet plasmids. With all the functions afforded by a living

  • Eww (Score:5, Funny)

    by Antipater ( 2053064 ) on Monday June 17, 2013 @12:56PM (#44030973)
    "Everything was going great, until the bank manager sprayed me in the face with his DNA!"
    • Could have been worse - the bank manager could have sprayed you in the face with packages containing half of his DNA (plus all of his mother's mitochondrial DNA) selected at more-or-less random form his own genome. Your "golden rain" scenario is barely kinkier than getting a "Robin Necklace".
  • I've never heard of applying DNA to a fleeing criminal with a gun. Sampling, yes, but not applying. A 9MM provides sufficient DNA samples.
  • by Karmashock ( 2415832 ) on Monday June 17, 2013 @01:24PM (#44031339)

    ... So... you couldn't just take a dip in a swimming pool?

    It goes without saying that once it becomes common knowledge that these things are being used thieves are going to burn their clothing after the heist. What then? Swab their bodies? Their lungs? The whole diver mask thing seemed to imply the air had to be filtered.

    • You are ignorant of the fact that "forensically aware" criminals have been doing this for years already? All this will do is add a washdown with a detergent-oxidising agent mix to the normal procedures of using clothing from the second-hand shop (if you can't use a painter's white paper suit, or a burka as a recent armed robbery in London did), laundering it or burning it as soon as possible after the crime (if you're going to "torch" the "motor" ... do all your clothes too).

      The only reason for criminals t

  • From the cited article:

    DNA Fog is an airborne suspension of artificial DNA molecules with a known but biologically inert sequence

    [emphasis mine]

    Because DNA is such a simple and easy to understand structure, spoke the head growing from ADNAS's ass.

    • Isn't it? It's a string made up of only four characters. Very simple. I thought it was also quite well understood which codons encode to which amino acids.

      Given that there's always someone ready to dump on any announcement of scientific advancement, I'm going to take ADNAS's word for it until an actual scientist turns up.

      DNA is inert outside of a cell anyway, isn't it?

      • by cfsops ( 2922481 )

        Sorry, I don't see this as a "scientific announcement". The company, Applied DNA Sciences [adnas.com], is not a research company, it's a for-profit business. From their web site:

        "Applied DNA Sciences delivers counterfeit protection, brand authentication, combats product diversion, and offers its award-winning programs against cash-in-transit crimes, all using the proven forensic power of DNA. With impenetrable taggants, high-resolution DNA authentication, and comprehensive reporting, our botanical DNA-based technologies deliver the greatest levels of security, deterrence and legal recourse strength."

        I'm not shitting on science, I'm questioning how a for-profit business is using science. I don't consider this an "advancement" any more than I consider Big Boy and Fat Man, or the myriad other weapons that came after, to be "advancements" of our understanding atomic science.

        • I'm not shitting on science, I'm questioning how a for-profit business is using science.

          You're not questioning. You're sarcastically implying (with no evidence given) that they don't know what they're talking about.

  • by slashmydots ( 2189826 ) on Monday June 17, 2013 @01:32PM (#44031451)
    Wow, I can see thieves and trespassers but for brigands you typically need to make a perception or arcane check roll to identify them.
  • Scenario (Score:4, Insightful)

    by goodmanj ( 234846 ) on Monday June 17, 2013 @01:38PM (#44031529)

    Here's a scenario for ya. You're on the scene on day ten of the latest round of anti-capitalist protests in Zucotti Park, New York city. The crowd gets a little unruly and a full-scale riot breaks out. A cop gets his head caved in with a brick, a couple people get trampled, and the tear gas and truncheon work gets underway. The crowd scatters and disperses, and you go home and wash the tear gas out of your eyes.

    Two days later, the cops show up at your apartment. It turns out they mixed a little DNA taggant into the tear gas grenades. They're going door to door throughout antiestablishment hot-spots in the city, asking for people to let them take a swab off their skin, so they can find the bastards who started the deadly riot. If you refuse, they apologize politely, and then swab your door handle on their way out.

    • Comment removed based on user account deletion
      • Actually, they effectively can. They simply arrest you, book you (where DNA taking is legal), and then fail to press charges, and release you. Knowing this is all legal, they can go door to door telling you that you can either give it, or they'll just arrest you and take it anyways.
        • Comment removed based on user account deletion
        • They simply arrest you, book you (where DNA taking is legal)

          Co-operate by letting them take a blood sample. You do have your lawyer lined up already, and they'll be present when the sample is taken, and will retain one of the duplicates.

      • It seems like you and your poster children have missed the "swab the door handle" comment. The police are allowed to knock on your door and politely ask you for something. IANAL, but I'm sure they're also allowed to swab your door handle as it's on the OUTSIDE of your house. If they find the DNA on the door handle, it would be easy to get a warrant based on that evidence.
        • I'm the original poster: glad you see what I did there. IANAL either, but I bet taking material from the outside of someone's house won't pass constitutional muster either, though it's much murkier than demanding a cheek swab.

          I'll be honest here and say that I didn't intend for this to be a totally realistic scenario... just one with enough truth to scare y'all. Think of it as the Slashdot equivalent of a spooky campfire story.

        • Comment removed based on user account deletion
        • If they find the DNA on the door handle, it would be easy to get a warrant based on that evidence.

          Which is why you took your gloves off before touching the door. Or you put them on, depending on which way you want to do the containment. Either way would work, but one carries evidence of forethought and planning.

    • You forgot to mention the undercover police or agents hidden among the people who were intentionally arousing tensions to provide the excuse for a crack-down.

    • Actually, DNA looks great under ultraviolet light. They can just shine a light on you at night, then they can swab you to make sure it's not yourself, or someone else, who sprayed their DNA all over you.

      • (1) you're already guilty for being at the crowd which became a riot ; your intentions are irrelevant, the crime is one of strict commission. The Riot Act was read ; the crowd was ordered to disperse ; you were there, as witnessed by the presence of the tags ; you're guilty. End of facts (unless you're going to dispute those facts, see below) ; start of sentencing phase.
      • (2) "and then swab your door handle on their way out." Why did you let them in. You're not obliged to let them in without a warrant. So d
  • by b4upoo ( 166390 ) on Monday June 17, 2013 @02:05PM (#44031841)

    In order to fight back for crime we will be offering a spray that contains cloned DNA from millions upon millions of people. That way DNA evidence will become worthless as it will appear that the population of large nations was in the room not to mention the expense of sorting all the DNA samples. Due to the tiny nature of DNA a handy one ounce spray bottle could fit in pocket. Keep in mind that if your thing is rape you will need to spray this stuff where the sun doesn't shine in order to confuse the issue. The woman would appear to have slept with 23 million people the day of the attack.

    • That way DNA evidence will become worthless as it will appear that the population of large nations was in the room not to mention the expense of sorting all the DNA samples.

      Which is why the DNA tags that they use contain biologically impossible DNA sequences. Or at least ones of implausibly low probability, such as (I construct a mapping of ASCII letter codes onto A="00", C="01", G="10", T="11" ; build a look-up table, make a translator ... for upper case only) "CCATCATACAACCCATCAGACACACATTCCCAAGAACCATCCCCC

  • Didn't I see something like this on an episode of Burn Notice a couple of years back?

    • I don't know what "Burn Notice" is, but this does sound very similar to the idea of "SmartWater" (leaving stains of lots of fluorescent dyes in unique combinations, 20 distinct dyes enabling a million distinct tags) from 20 years ago. And explosive tracing from the decade before (shreds of plastics in the explosive ; enough survive to provide a fingerprint. And enough to contaminate the whole environment.)

      Remember when having traces of cocaine on a five-pound note was sufficient to get you jailed?

  • Now B&E experts will start wearing latex gimp suits...

  • I'm cool with dye packs. They're immediate, short-range, they make it very visible that you're the bad-guy or were at least near the money at some point. In the days / hours following the heist there's a chance someone saw a fluorescent blue guy running around. Maybe you were part of the crime or maybe you were near a discarded pack when it went off. In either case, it's a visibly obvious way to at least track where the money was going.

    So: short range, easy to notice (and complain about) accidental expo

  • I spray you with guilty DNA. Stage a robbery. Call the cops.

    just replace "I" with whoever it is you least trust.. the government, the government when dealing with Julian Assange or like case, businesses dealing with employees they think might become whistleblowers ... just use you imagination. We all know what people are capable of...

    It's time for us all to become a lot more skeptical of the seemingly "definitive" information made available to us via technology. Basically, be highly skeptical of any technol

  • Just splendid -- giant mutant criminals. What say we just pelt them with radioactive spiders and have done with it?

  • Rottweiler DNA in the bite marks in burglars' asses.

  • What about people that have been in contact with the tagged person? I guess they will carry some tagged DNA as well. How false postiive are avoided?

How many weeks are there in a light year?

Working...