DNA Fog Helps Identify Trespassers, Thieves, and Brigands 129
Zothecula writes "Applied DNA Sciences (ADNAS) has developed a new approach to solve crimes using DNA tagging. The difference is that instead of tagging the objects being stolen, the company's system tags the perpetrator with DNA. While this has been tried before by applying the DNA to a fleeing criminal with a gun, ADNAS has adopted a more subtle approach."
Re: (Score:3, Funny)
They're brigands and blaggards; those dirty vamints. These dastardly perpetrators must be stopped forthwith! What do you think, old bean?
Re:"Brigands" (Score:5, Funny)
Re: (Score:2)
Re: (Score:2)
Re:"Brigands" (Score:5, Funny)
I was thinking more "Why DNA instead of fluorescent dye?"
For truly efficient brigand-tracking, you want a globally-unique taggant, rather than being limited to the few dozen-ish colors of fluorescent dye...
Just imagine! Incentivize your riot cops during the next protest by mixing a unique DNA tag into each one's pepper spray and then analyzing the detainees. The more dirty hippies with your spray on 'em, the better your chance to win the department raffle!
Re: (Score:1)
My god... you've invented competitive hippy punching!
Science. It works, bitches.
Why stop there? (Score:2)
Why not fog the warehouse with cold viruses that give you flourescent green boogers?
Re: (Score:2)
Re:Why stop there? (Score:5, Funny)
A "Man Trap" is considered legal to have?
I hope so. I married one.
Re: (Score:2)
Beware the Venusian Mantrap.
Re: (Score:2)
Re: (Score:2)
Re: (Score:2)
That doesn't make it wrong!
Re: (Score:2)
Re: (Score:2)
I just looked up "ghost pepper". I'd heard of the Scoville scale years ago. This one can hit a million. +1 Internets to you, AC.
https://en.wikipedia.org/wiki/Scoville_scale [wikipedia.org]
Re: (Score:3)
A friend told me of a time at TPC where a plate of brownies laced with Ex-Lax was left in the fridge for the resident fridge thief. It worked well. Five brownies were missing. The suspected thief clocked out sick less than an hour into his shift and there was evidence that he didn't make it out of the building without shitting himself.
Re: (Score:2)
Nah, why not fog the warehouse with "fog":
https://www.youtube.com/watch?v=2tobb0igeGQ [youtube.com]
https://www.youtube.com/watch?v=cAPw_xbTJzk [youtube.com]
https://www.youtube.com/watch?v=Q4fd88DhN5I [youtube.com]
Seems more likely to reduce your losses than some DNA fog which the cops will never bother with (unless perhaps someone is killed).
Why start there? (Score:2)
Seriously, UV dye taggants have been around for decades. You sprinkle fairy dust on the stuff you don't want touched, then UV shine the people who might have touched it. If their fingers glow, they're a suspect; you have probable cause to check them for stolen property. But if they go home and wash their hands, that means you failed to catch them in the act and you suck at your job as a security person.
Being near the ventilation system outlets, or washing the clothes of a warehouse employee, or of sittin
Why not just use Skunk odors.... (Score:2)
...that's a spray, and the smell is fairly easy to follow.
Seriously, this sounds pretty interesting, and scary all at the same time. It has the potential to last years, but it appears that a Police swab would be necessary. Why not make it so it's luminescent thus allowing a special light to be used to detect the DNA? This would prevent the need of the swab and the refusal of a perpetrator from providing the sample.
Just a thought.
Re: (Score:1)
It wouldn't help you track the brigand to tag them with just DNA, you would have to pick them up for something else or have enough evidence for probable cause before you could even swab them or their belongings. I am however sure a police dog could be trained to track a some kind of oil based scent that would be really hard to remove like a skunk scent. Then everything in of your store/warehouse/factory/home would be tagged with it as well so I don't think that would work either.
Re:Why not just use Skunk odors.... (Score:5, Interesting)
Ah, at last someone gets to the crux of the matter.
You still have to find the perp via some other means.
Then take DNA samples and process those. But wait, you also have to sequester every cop who visited the crime scene and not let them touch any evidence for weeks on end. And not just the evidence from one crime scene, but all the crime scenes using this technology. Once the cops set foot on the premises they too will be tagged. As well as their wives and co-workers that come in contact with their uniforms, objects they handled, and any perps they happen to apprehend.
Your average burglary detective would spread the DNA from several recent robberies to every suspect they hauled in. Would do wonders for their arrest rates. *cough*.
So the DNA taging system builds a web of uselessness around itself, which spreads wider daily, while at the same time provides not a single additional clue to help you catch the thief.
And I don't believe that bit about being hard to wash off either. After all, if you can sample it by simply using a swab, how tightly can it be bound?
Re: (Score:1)
Shortly after they had new security cameras professionally installed at work, I called the site director over and had him watch the dvr screen. I told him to watch me walk out of the building and back in... I walked out of the building normally and off camera then walked back in at angles I knew the cameras where missing when I got back to the office he says "I thought you were pulling a prank and just went to lunch cause I didn't see you coming back".
He ended up calling them back to fix it. I think the bui
Re: (Score:2)
I think the police would ban the use of thiols at crime scenes after their first investigation. "You want me to go IN THERE and bag evidence? Fuck that, I'm on sick leave
The end of crime (Score:1)
Because this could NEVER-EVER be misused.
Comment removed (Score:4, Insightful)
Re: (Score:2)
Yup, it's not like the clothing could be washed & dried in a public laundromat and the next fifty people to use it become suspects.
Well the detectives investigating the crime scene will pick up quite a load of this DNA too. So any random person they choose to get off the streets and puff up their arrest record will be tagged as the detectives grab them and cuff them. And sure enough, the tags will match.
Re: (Score:2)
Maybe the article was badly written, but at face value, it seems like a dumb idea to begin with. DNA molecules of any practical size are much to large to be suspended in the air for long. Any surface that is non-sterile is filled with nucleases released by microorganisms and endogenous enzymes from the human body that will quickly degrade your DNA beyond recognition. It would be as if those dye packs being used by banks are water soluble. All a criminal needs to do is do laundry and take a shower to eli
Re: (Score:3)
Plus, the security guard who responds to the alarm will probably get the DNA all over themselves as well. And security people are always on the first list of suspects, so every job will appear to be an inside job, OR the security people will be free to steal whatever they want, since they have an alibi for having the DNA on them.
Until the security guards learn to just not respond to alarms. Which means the cops are free to steal as much as they want, since THEY will be the ones to have the DNA all over th
Re: (Score:2)
"degrade" , yes ; "beyond recognition", no.
Forensic scientists and archaeologists - in fact, almost anyone who works with DNA and isn't a medic - are well used to working with contaminated, multiple-source DNA samples. It does make the job harder (which is why in the real world you'll only hear DNA evidence presented as probabil
Re: (Score:2)
I would defer on matters pertaining to the specific robustness of forensic analysis to others with more experience in the particular field. However, as someone who has an annoying number of experiments fail due to contamination and other mysteries of the often fragile and fickle nature of DNA/RNA, I wonder why someone would bother *intentionally* use it to construct a tool in this manner. If you were to design a bio-metric ID tagging system from the ground up, you don't have to limit yourself to the means
Re: (Score:2)
Your revised scheme :
Depending on how you do your accounting, and the relative costs of your materials (declining as production volumes increase) versus your labour (may decline if you can move it down from skilled lab workers to MacDonald's burger-flipping rejects), you've increased your costs by between 30% and 50%.
Re: (Score:2)
It doesn't necessarily have to be more costly. (Or perhaps trivially so) On the other hand the additional cost could be value added features that enhance the usefulness of the tags. The tags can be engineered and packaged to any degree that can be implemented with current technology. Having thought about this now for a few days, I think one very viable option is to maintain the tags *inside* a bacterial host as part of its chromosome or as discreet plasmids. With all the functions afforded by a living
Re: (Score:1)
Grammar could possible go wrong.
Eww (Score:5, Funny)
Re: (Score:2)
Application with a gun (Score:2)
Must...Not...Make...DNA...Tagged..Underwear...Joke (Score:1)
Re: (Score:2)
I thought bleach destroyed that stuff. (Score:3)
... So... you couldn't just take a dip in a swimming pool?
It goes without saying that once it becomes common knowledge that these things are being used thieves are going to burn their clothing after the heist. What then? Swab their bodies? Their lungs? The whole diver mask thing seemed to imply the air had to be filtered.
Re: (Score:2)
The only reason for criminals t
Brilliant. (Score:1)
From the cited article:
DNA Fog is an airborne suspension of artificial DNA molecules with a known but biologically inert sequence
[emphasis mine]
Because DNA is such a simple and easy to understand structure, spoke the head growing from ADNAS's ass.
Re: (Score:2)
Isn't it? It's a string made up of only four characters. Very simple. I thought it was also quite well understood which codons encode to which amino acids.
Given that there's always someone ready to dump on any announcement of scientific advancement, I'm going to take ADNAS's word for it until an actual scientist turns up.
DNA is inert outside of a cell anyway, isn't it?
Re: (Score:1)
Sorry, I don't see this as a "scientific announcement". The company, Applied DNA Sciences [adnas.com], is not a research company, it's a for-profit business. From their web site:
"Applied DNA Sciences delivers counterfeit protection, brand authentication, combats product diversion, and offers its award-winning programs against cash-in-transit crimes, all using the proven forensic power of DNA. With impenetrable taggants, high-resolution DNA authentication, and comprehensive reporting, our botanical DNA-based technologies deliver the greatest levels of security, deterrence and legal recourse strength."
I'm not shitting on science, I'm questioning how a for-profit business is using science. I don't consider this an "advancement" any more than I consider Big Boy and Fat Man, or the myriad other weapons that came after, to be "advancements" of our understanding atomic science.
Re: (Score:2)
I'm not shitting on science, I'm questioning how a for-profit business is using science.
You're not questioning. You're sarcastically implying (with no evidence given) that they don't know what they're talking about.
amazing (Score:3)
Scenario (Score:4, Insightful)
Here's a scenario for ya. You're on the scene on day ten of the latest round of anti-capitalist protests in Zucotti Park, New York city. The crowd gets a little unruly and a full-scale riot breaks out. A cop gets his head caved in with a brick, a couple people get trampled, and the tear gas and truncheon work gets underway. The crowd scatters and disperses, and you go home and wash the tear gas out of your eyes.
Two days later, the cops show up at your apartment. It turns out they mixed a little DNA taggant into the tear gas grenades. They're going door to door throughout antiestablishment hot-spots in the city, asking for people to let them take a swab off their skin, so they can find the bastards who started the deadly riot. If you refuse, they apologize politely, and then swab your door handle on their way out.
Re: (Score:2)
Re: (Score:3)
Re: (Score:2)
Re: (Score:2)
Co-operate by letting them take a blood sample. You do have your lawyer lined up already, and they'll be present when the sample is taken, and will retain one of the duplicates.
Swab the door handle (Score:2)
Re: (Score:2)
I'm the original poster: glad you see what I did there. IANAL either, but I bet taking material from the outside of someone's house won't pass constitutional muster either, though it's much murkier than demanding a cheek swab.
I'll be honest here and say that I didn't intend for this to be a totally realistic scenario... just one with enough truth to scare y'all. Think of it as the Slashdot equivalent of a spooky campfire story.
Re: (Score:3)
Re: (Score:3)
Re: (Score:2)
Which is why you took your gloves off before touching the door. Or you put them on, depending on which way you want to do the containment. Either way would work, but one carries evidence of forethought and planning.
You forgot to mention the Agent Provocateurs (Score:2)
You forgot to mention the undercover police or agents hidden among the people who were intentionally arousing tensions to provide the excuse for a crack-down.
Re: (Score:2)
Actually, DNA looks great under ultraviolet light. They can just shine a light on you at night, then they can swab you to make sure it's not yourself, or someone else, who sprayed their DNA all over you.
Re: (Score:2)
Re: (Score:2)
The biggest difference between facial recognition and DNA fingerprinting is that DNA fingerprinting actually works.
Re: (Score:2)
It ain't perfect, but it's without a doubt the most reliable criminal identification tool we've got. If we go back to rigged line-ups and botched fingerprint analysis, the world will be a less just place.
And a good defense counsel will make sure the jury knows about the potential problems of DNA matching. I served on a jury in which we rejected badly-collected DNA evidence and (for that reason and many others) acquitted the defendant.
Re: (Score:1)
Mad Scientist (Score:3)
In order to fight back for crime we will be offering a spray that contains cloned DNA from millions upon millions of people. That way DNA evidence will become worthless as it will appear that the population of large nations was in the room not to mention the expense of sorting all the DNA samples. Due to the tiny nature of DNA a handy one ounce spray bottle could fit in pocket. Keep in mind that if your thing is rape you will need to spray this stuff where the sun doesn't shine in order to confuse the issue. The woman would appear to have slept with 23 million people the day of the attack.
Re: (Score:2)
Which is why the DNA tags that they use contain biologically impossible DNA sequences. Or at least ones of implausibly low probability, such as (I construct a mapping of ASCII letter codes onto A="00", C="01", G="10", T="11" ; build a look-up table, make a translator ... for upper case only) "CCATCATACAACCCATCAGACACACATTCCCAAGAACCATCCCCC
Re: (Score:2)
It wouldn't take much to cross-contaminate it and make it utterly worthless though. It's hard enough to filter out one reference sample (victim) from the perp's DNA to get a clean read. And labs have to take some pretty extraordinary measures to make sure none of the suspect's reference sample mixes with the crime scene sample to avoid a false positive. Throw a random mix of a bunch of other people's DNA in there and you would probably mess it up enough to make the sample worthless. Granted, I wouldn't
Re: (Score:2)
The suspects reference sample should be tested at an entirely different facility from the crime scene samples.
Burn Notice (Score:1)
Didn't I see something like this on an episode of Burn Notice a couple of years back?
Re: (Score:2)
Remember when having traces of cocaine on a five-pound note was sufficient to get you jailed?
B&E style change.... (Score:2)
Now B&E experts will start wearing latex gimp suits...
Re: (Score:2)
Mixed feelings, dye packs are fine. But this? (Score:2)
I'm cool with dye packs. They're immediate, short-range, they make it very visible that you're the bad-guy or were at least near the money at some point. In the days / hours following the heist there's a chance someone saw a fluorescent blue guy running around. Maybe you were part of the crime or maybe you were near a discarded pack when it went off. In either case, it's a visibly obvious way to at least track where the money was going.
So: short range, easy to notice (and complain about) accidental expo
Re: (Score:2)
To play devil's advocate I can see one logical reason
By using the x-million (or whatever) combinations of the DNA sequence it acts like a barcode. So just because you have some random DNA sludge on you from one place doesn't mean you have it from the place they're looking at.
With chemicals you're limited in the combinations. Sure you can have chemical markers like most of the chemical products out there have (this % of inert compound is batch A, % of that inert compound is batch B%). But if you're talkin
Re: (Score:2)
Because there happens to already be a cheap way of amplifying a small sample of DNA for identification (PCR).
Most other easy to manufacture serializable microscopic substances mostly suffer from dillution/detection problems.
The technique is to use junk DNA encoded with a serial number. DNA are the is the microscopic grains and PCR is the way to quickly do the detection if a specific serial number is present (although PCR isn't yet as simple as a swab).
Presumably you could spend years doing revolutionary no
I hate you. (Score:2)
I spray you with guilty DNA. Stage a robbery. Call the cops.
just replace "I" with whoever it is you least trust.. the government, the government when dealing with Julian Assange or like case, businesses dealing with employees they think might become whistleblowers ... just use you imagination. We all know what people are capable of...
It's time for us all to become a lot more skeptical of the seemingly "definitive" information made available to us via technology. Basically, be highly skeptical of any technol
Splendid (Score:2)
Just splendid -- giant mutant criminals. What say we just pelt them with radioactive spiders and have done with it?
Prior art (Score:2)
Rottweiler DNA in the bite marks in burglars' asses.
False positive (Score:2)
Re: (Score:2)
Zardoz teaches : "The PENIS is EVIL"! (Score:3)
Re: (Score:2)
Re: (Score:2)
Re: (Score:2)
do your sperm travel in single file?
Only when sufficiently beaten into submission.