




UK-Developed 'DNA Spray' Marks Dutch Thieves With Trackable Water 191
eldavojohn writes "In Rotterdam, there's a new technology in place that dispenses a barely visible mist over those around it and alerts the police. The purpose? To tag robbers and link them back to the scene of the crime. From the article, 'The mist — visible only under ultraviolet light — carries DNA markers particular to the location, enabling the police to match the burglar with the place burgled. Now, a sign on the front door of the McDonald's prominently warns potential thieves of the spray's presence: "You Steal, You're Marked."' Developed in Britain, it's yet to nab a criminal but it will be interesting to see whether or not synthesized DNA will hold up as sufficient evidence in an actual court of law." So it's not just for copper thieves.
"visible only under ultraviolet light" (Score:2)
"visible only under ultraviolet light"
Then it can't be used in the night clubs as those "black lights" will make-it VERY visible.
Beef spray (Score:5, Funny)
Well, that's the first thing they'll serve with actual DNA in it, then.
Re: (Score:2)
I think this proves keeping CCV cameras well maintained and working - is cheaper and better
Except the popularity of hoodies is partly down to the fact that they obscure the face from CCTV cameras (and partly down to them being comfortable and convenient, of course).
Re: (Score:2)
But why ? (Score:2)
I understand new tech is nice and all.... But what's wrong with a simple camera ? Or a burglar alarm ? Why bother with these high flying ideas ? I understand that insurance is practically non existant for comanies, but how high costs do you really need to incur to "secure" yourself ?
You can't even trace the burglar as I understand it, you have to actually find him, and then test people for the presense of the mist. I dont see this a commercially viable product, even if it pans out as permissable in a court
Re:But why ? (Score:5, Informative)
Re: (Score:2, Informative)
Thieves wear hoods, motorcycle helmets, stockings... Alarms go off so often that responses are slow, if at all: a burglar can be in and out long before the alarm is responded to,
Since the spray is highly personalized, you can shine an ultra-violet light on a suspect - which they will have difficulty objecting to - and trace them back to a crime for which you may not even have suspected them. If it is the case, as commonly alleged, that the majority of crime is committed by a small number of people, then you
Re: (Score:2)
Indeed they wear hoods. And disguise themselves. But if you dont catch the culprit, then what's the point of this particular peiece of invention ? I concur, when you gather up "the usual suspects", you're likely to get a hit once in a while, but IMO an ounce of prevention is orth a pound of cure. I dont really see this product as something the local macdonalds will want to invest in to protect their friers, or even households to protect their TV.
In essense (and I may be wrong here), this product only seems
Re: (Score:2)
Shining an ultraviolet light on someone can be done without a warrant. You can approach every group of teens/thugs in a two mile radius and check them, and then have probable cause for an arrest. Otherwise it's less legal to detain a group of kids walking two block away when there's no proof they were involved at all.
Re: (Score:2)
1 - Buy spray synthesiser machine.
2 - Make it known that you offer a safety service to bank robbers: they come to you once sprayed and you make 100l of the substance for them to spray on the streets for a week.
3 - Profit.
4 - ???
Re: (Score:2)
Because Alarms don't follow thieves.
Defense in depth. I doubt any company is going to remove their CCTV and alarms but this provides yet another layer of defense. This layer also follows the theif & stolen property. Better yet use them in conjuction. Tag property w/ the marker and also have mister which goes off when alarm sounds.
It is all about defense in depth.
As DNA technology gets cheaper and more advanced who knows in 20-30 years Police dept might have a device they swab the marker, put it on a
Re: (Score:2)
If you can stop an alarm then you can stop this device from spraying you. Somehow this device has to be set off, whe
Beware my tiger repellant rock (Score:5, Insightful)
I don't see any burglars, so it has to be working.
The jokes are too obvious (Score:3, Funny)
They're spraying their DNA over customers, and it shows up under a blacklight?
Oh, come on! This is just too easy.
that is a one-time success (Score:2)
otherwise it will be duplicated and sprayed freely - f.e. on court-staff
Also checking for duplicate natural DNA showing the same pattern has to be done - no one can exclude this!
Re: (Score:3, Informative)
they will have to change the DNA marker after one use....Also checking for duplicate natural DNA
Smartwater [wikipedia.org] uses various methods to encode a unique signature. No actual DNA is involved.
"DNA spray" ? (Score:2)
Re: (Score:2)
They jizz on my pants?
No, only your blue dress.
Old news is old (Score:3, Informative)
I first heard of this stuff about 10 years ago, under the name "SmartWater" - http://en.wikipedia.org/wiki/SmartWater [wikipedia.org]
IIRC it won some kind of 'Millenium Award' in 1999 or 2000
! DNA (Score:3, Informative)
As far as I can tell, it's not only not new, but it also has nothing to do with DNA. The marker is either a unique proportion of certain non-evaporating particles, or small engraved chips with a number on them.
DNA has nothing to do with this, even in an abstract sense -- it is not self-replicating, and certainly not biological.
Perfect security? (Score:2)
And again, here's the typical 'It's perfect because nobody robbed us yet' argument. If only a few percent of the stores are equiped with this 'DNA spray', I'm pretty sure that the criminals will target the other 95+% of the stores with more traditional security measures.
We'll only know if this works if a significant percentage of the jewelries and retail stores in the neighbourhood are equiped with this. Criminals are creative, but above all they're lazy, just like us developers :P
Hamburglar (Score:3, Funny)
This is an elaborate scheme to finally stop the Hamburglar, the masked hamburger stealer, who the company strangely uses as a commercial icon.
Re: (Score:2)
It's no different than the Lucky Charms leprechaun or the Trix rabbit.
Can we put this spray on corporate lobbyists? (Score:4, Funny)
Silly Slashdot crowd even goes for the buzzwords (Score:5, Informative)
Who's DNA are they using? (Score:2)
Prawo Jazdy's?
Cancer? (Score:2)
Somebody will be suing claiming it causes cancer. Or bronchitis at the very least.
We've been waiting for the first major nanotech lawsuit for a while, and this may be it.
HAL.
Bruce Scheier got here first, but: (Score:2)
What's stopping me from getting my own DNA water, and spraying it all over your stuff that I want to steal?
McDonald's? (Score:2)
Now, a sign on the front door of the McDonald's prominently warns potential thieves of the spray's presence: "You Steal, You're Marked."
But, nothing tastes quite as good as the McRib you make yourself for free!
Great - Macdonalds pissing on its customers (Score:2)
"fine mist with trace of DNA" my arse.
Re:Water? (Score:5, Interesting)
Seriously? I'm no scientist, but it seems like a good scrubbing and you'd make a clean getaway. Har har...
Good joke; but since you are no scientist, perhaps you wouldn't know that they even think about these trivial, blindingly obvious things and test for them.
Nope, mate, what you see here is a bloody clever thing, and not something you can easily find a way out of. DNA sequences can be purpose built nowadays, and soon it will be cheap enough for everybody to buy. The number of variations are practically unlimited, so you could more or less mark every brick in London with their own, individual marker, and you can't just wash it off and be sure not to carry it around with you; plus of course they don't put a big sticker on the outside of marked objects to warn you. If you want to avoid carrying this stuff around with you, you will have to put on a full environment suit, and since you never know where you can come across this stuff, you will have to do it every time you do something you don't want to be nicked for. The problem with environment suits is, they tend to stand out, of course.
Re: (Score:2)
So, soon not only the robbed people will be able to buy one of those markers - other people will be able to do it too.
This probably means, even if this now has some chance of being accepted in court, it will (I hope) be droped when they find anyone can be framed by the real burglar, if she gets the chance to build the same sequence with the same environmental markers.
A good question is, perhaps, whether it wil
Re:Water? (Score:5, Insightful)
Actually I'd expect it to be even worse, thanks to the CSI effect. Basically the same blind belief that if it's some hi-tech shit, then it's more infallible than the Pope and those scientists 100% thought of and prevented every possible problem or false positive, that you can see in the GP post.
Someone _will_ get sent to jail by some idiot jury because the real burglar -- who, for example, is an employee and didn't even need to synthetise anything: he just nicked the bottle that the PHB cleverly hid in his desk drawer -- sprayed them with it.
That's actually the important part: often when it looks like there's some impossible hurdle like synthetising DNA, there are often _much_ simpler ways to plant it, _and_ you can rely on some idiots still thinking that only the really complicated way exists. E.g., people have already planted DNA at a crime scene by just taking a cigarette butt from a bus station and dropping it there. Here you don't even have to do that.
Or as an even more trivial example, if a co-worker you really don't like leaves his coat behind and his wallet in it, spray the coat and banknotes in the wallet, steal the same amount from the cash register, tip someone off that you saw them stealing again. Double profit. You got the money, and got rid of that guy or gal you don't like.
Yeah, they'll end up having to convince a jury that those scientists and their hi-tech solution are fallible after all. Good luck with that in a world being told the opposite by PR. And where they saw on TV every week that you can take a hair you found on a carpet and know exactly that it belongs to the killer (and not, say, to one of the guests the victim had two days before that, or some guy in the bus leaving hair on her coat) and run a DNA analysis to tell you exactly what the killer looks like. Or that you can take a two by two pixel image of the back of someone's head from a security camera, enhance it to a clear 1600x1200 image and, with a couple more mouse clicks, turn it around to see the culprit's face.
Seriously, we're already at the point where some juries acquit because you didn't do that, or conversely people who spent time on the death row because some pseudo-science mumbo-jumbo must be 100% correct and accurate like on CSI.
Re: (Score:2)
Couldn't agree with you more. It's a sad day when xkcd [xkcd.com] can be used legitimately in court.
Re: (Score:2)
Fortunately that tends not to happen in the UK. Unfortunately the alternative isn't that much better.
We rely on experts to testify about evidence. Thus it is down to your defence team to get a good expert to contest the bullshit that the prosecution's expert is saying.
That tends to happen during the appeal phase, well after the innocent person has already served years in jail. The most high profile case recently was Barry George. The police said that a single spec of gunpowder on his clothes proves he fired
That's actually standard procedure (Score:2)
That you get to listen to expert witnesses is AFAIK standard procedure in all of the western world. It still didn't prevent jury nullification because the jury thought the prosecutor must be full of it if they don't have some techno-magic CSI-style analysis to go with all the witnesses, or conversely convicted based on misunderstanding how reliable some piece of techno-babble really is. I doubt that the UK or any other country is immune to that, and judging by your examples, you're basically saying the same
Re: (Score:3, Insightful)
That's a pretty massive 'if'.
I think you overestimate the sort of person who robs McDonalds, if they had a second brain cell to keep the first one company they wouldn't be doing it.
Masterminding some sort of DNA-resequencing plan? Not so much.
marking your posessions (Score:3, Funny)
I mean, why pay some company for synthetic markers, when you already have your own custom-tailored ones for free?
Re: (Score:3, Informative)
Why not just buy some of this spray, covertly spray some around a jewellery shop and then report them to the police for handling your stolen property?
Most thieves either get caught at the scene or they get away and the police eventually track them down much later. After multiple showers and scrubbing I doubt that there would be enough of this stuff left to get a positive DNA match. Don't forget that the police have lied about the accuracy and reliability of DNA. The Omagh bombing trial collapsed because the
Re: (Score:2)
The shop will have their receipts in good order, will you have yours?
Re: (Score:2)
I have news for you: you can print your own receipts!
Shops don't have magical receipt printing machines. They are the same printers everyone else can buy.
Re: (Score:2)
Duh! Let me spell it out: I think the police know how to check a paper trail. Expensive jewelery in a shop will have more than a thermal paper till receipt behind it.
Besides, there's no way you'd be able to spray it without being noticed and just leaving a few fingerprints on it from looking at it wouldn't be the same.
Re: (Score:2)
Be aware of Printer steganography [wikipedia.org], which makes it easy to detect that you forged all your receipts with the same printer.
Re: (Score:2)
Most thieves don't get caught at all; I think the statistic is one in ten get caught.
Re: (Score:3, Informative)
Err, yes the do. RTFA and see the big orange sign.
Also, DNA can degrade fairly quickly if it is not part of a living cell and there are many chemicals that can break DNA down.
Re: (Score:2)
Companies like this one [selectamark.co.uk] sell a DNA "paint" which you can use to mark your belongings.
Microdot security paint (like this [immobilise.com]) isn't DNA, but can last through a fire.
Re: (Score:2)
plus of course they don't put a big sticker on the outside of marked objects to warn you.
From the summary: "Now, a sign on the front door of the McDonald's prominently warns potential thieves of the spray's presence".
Re: (Score:3, Insightful)
Maybe we're overestimating the intelligence of people who'll walk past a big orange sign in broad daylight and rob a McDonalds.
Re: (Score:2)
It's interesting how technology developed from personalized crafts where each creation was unique to the mass manufacture with identical copies of the same product (often fully automated, which insures that those copies are indistinguishable) to the artificially personalized copies of the product - unique id tags, serial numbers were superficial and mostly easily removable from the product, but those two recent developments indicate that manufacturers and owners will go at length to make sure that the added
Re:Water? (Score:5, Informative)
I would guess, the product in question is http://smartwater.com/ [smartwater.com]
Living in the UK a few years back, I had started using it to mark belongings of mine, after a friend working for the police recommended it.
The stuff is almost transparent - but, when I applied it to a grey camera lens - it's still easily visible on it -- on black or white lenses it's not much of a problem.
On the greyish lens, I tried to wash it off - and have found that I couldn't (wet wipes, ...).
The stuff sticks fairly well - I can't even say I managed to get a noticable amount of it off.
As far as marking belongings goes - you literally only need a very small spot of it; and you can pick some place where it isn't too obvious. On my Nikon lenses, I sometimes put the spot on the 'o' in the Nikon logo. Trying to get this off would probably seriously (cosmetically) harm the lens; scratch off part of the logo - and the resale value will drop massively: No point trying to call it 'near mint condition' afterwards.
Under UV light, the spot is easily visible - under normal light, it's near invisible.
From another friend who works as a shop fitter for jewellers, he's tried it in alarm systems, and he told me, that it will take a few days/weeks before you get all of it off (i.e. small amounts still lodged in skin pores are almost impossible to get out easily).
Re: (Score:2)
I would guess, the product in question is http://smartwater.com/ [smartwater.com]
Given the right DNA sequence? Sure, i guess it could be smart!
Re: (Score:2)
Yes, but not always understood.
Re: (Score:2)
Re: (Score:3, Interesting)
It does. To an extent. Not enough though.
The PCR techniques used to amplify it for detection purposes are so sensitive that enough remains can be picked up by crimelab.
The only way to reliably "clean" clothing that has come into contact with this is to dip it in DNAases (enzymes that specifically hydrolise DNA). These are actually quite easy to come by in Holland. Holland is one of the world capitals of developing "pumped up" chicken meat. That used to be "pumped up" with crude pork and beef proteins extra
Re:Water? (Score:5, Funny)
Whew! And here I was afraid the spray was just cat pee.
Nothing gets that stuff off.
Re: (Score:2)
Yes, but with Nature's Miracle you don't have to. Just leave it there and no one will ever know.
http://www.colbertnation.com/the-colbert-report-videos/49811/january-18-2006/bring--em-back-or-leave--em-dead---teacher-s-edition [colbertnation.com]
Re: (Score:2)
Just talk to your "halal" (quotes intended as it is stuffed with pork to the hilt) cheap chicken supplier.
You seriously think they use denatured beef and pork protein in halal chicken? If that's true it would upset the Jews, Muslims, and Hindu's something crazy.
Do you have any evidence chicken producers do that? A URL or anything?
Re: (Score:2)
Re: (Score:2)
Do you have any evidence chicken producers do that? A URL or anything?
What are you, crazy? This is /.!
Re: (Score:2)
They do. If it ends up being sold as halal/kosher is a different matter. It would not surprise me as it is rarely labled as such and is often repackaged in the country that imports it.
http://news.bbc.co.uk/1/hi/uk/3006192.stm [bbc.co.uk]
Re: (Score:2)
...and more harmful to the colors!
Re: (Score:2)
Thieves are not generally known for their intelligence. Even if they were aware of the magic dye, they would have to arm themselves with a black light and literally scrub everything - themselves, their clothes, their shoes, their car, the trail of drips / prints, and anything they touched for the police to be no better off than if the dye system had not
Re: (Score:3, Interesting)
Re: (Score:2)
1. Buy your own unique DNA spray
2. Steal shit
3. Tag the stolen goods with your spray, and maybe scratch off serial numbers or other identifying information
4.
Re: (Score:2)
Step 5 and 6 are more likely to be "5. The police give you a case number to chalk up for your insurance, which will then go up, and never look at the case again" and "6. Homeless guy gets away with your fancy equipment and is never to be seen again".
Why do you think the police don't care? Because they're too bus
Re: (Score:2)
Why are the crime rates too high?
The crimerates are mainly high because a lot of stuff is classified as crime which shouldn't. Stop the War on Drugs and a lot of problems with crime would solve themselves, giving cops time to deal with real criminals.
Re: (Score:2)
Crime rates in US are at 30 year low. So what is this about crime is too high?
Perception due to 24/7 media exposure is that crime rates are high. Then again reality doesn't really care about perception.
Re: (Score:2)
It's far more likely to be used along with other evidence, i.e. used to refute a police statement where they denied being in that part of town that day, or if they claim to have been in the bank (but a few tellers down, and hence sprayed), used with video surveillance to show weren't.
Re: (Score:2)
Thieves that get caught are not generally known for their intelligence.
Fixed that for ya.
Re: (Score:2)
Who do you think would be busting into a run down McDonalds? Raffles the Gentleman Thief?
It's probably a gang of scumbags from the nearest housing estate. Chances are the cops would suspect who did it and presence of the dye on any of them would easily confirm it.
Re: (Score:2)
Re:Water? (Score:5, Interesting)
Of everything. Because this is a fine mist that will stick to everything, even your hands, shoes, clothes, socks, the bag, the tools, the stolen property. So you'd need to do a job and then ditch everything you have in a forensically secure way. I've used a similar competing product called SmartWater.
The beauty of things like SmartWater is that its a suspension of fine molecules that can be *uniquely* identified to a particular user (i.e. you get a coded bottle with a unique number and a unique solution). The UV is just there to light up when people go through police stations but the chemical itself is, supposedly, uniquely identifiable.
Answering "How did you come to have UV marker solution on your clothes?" is easy. You were security marking your own equipment, you work with the stuff all the time, it must have been on something you picked up, maybe someone was playing a prank. Answering "How did you come to have a UV marker solution on the clothes you wore last night that is ONLY issued to Company X, when there was a burglary at Company X last night, when you claim to have been at home and never near Company X?" is a bit more tricky, especially if it's a fine mist that soaks into anything and everything it touches.
I've used the SmartWater stuff, which is very similar to this, and it's a wonderful deterrent. They claim to have a 100% conviction rate when property / people are found by police with SmartWater on them and given that they are often used in bank security vans, that's quite impressive. I don't know if that was true, or still is, but it's plausible. Basically if the police find the tiniest forensic trace of that stuff on property / people they question, they can take a sample, send it to the company, who will tell them who bought that EXACT pot of tracer ink. I also know from experience that a 50ml pot of SmartWater is enough to chemically mark every PC or electrical item in a school several times a year and last several years.
This stuff isn't just a UV-tracer. It puts you, forensically, at the exact scene of a particular crime. And given that I know of no lawsuits with any of these stuff being in question, they must have a pretty cast-iron chemical description that can satisfy a court of law or, at least, people who are caught with it on their clothes that it wouldn't be worth challenging.
It's also very good for equipment recovery. It basically guarantees identificiation / return of stolen property if it comes into police hands. Before, even if your stuff was security marked, it wasn't guaranteed that you would get it back (the first thing is that people try to file off the security marks - I've had police tell me of cases where they had to return goods with obviously filed-off security marks because they couldn't prove it WASN'T the suspected thieves and couldn't trace the actual owner), but with SmartWater once it's in police possession even the smallest tiny speck of SmartWater (which can be deployed even on hard-to-cleanse areas like across the PCB's of (unpowered) motherboards) or similar will link it to it's owner.
Re: (Score:2)
Answering "How did you come to have a UV marker solution on the clothes you wore last night that is ONLY issued to Company X, when there was a burglary at Company X last night, when you claim to have been at home and never near Company X?" is a bit more tricky
A: Yesterday, a guy in the street sprayed me with a substance I didn't identify. I tried to chase down the guy to ask for an explanation but he ran faster than me.
Re: (Score:3, Insightful)
I'm very sceptical about DNA evidence being used to convict. I'm a lot less sceptical about evidence like this being used to build a compelling case alongside other evidence, or to narrow enquiries. You can, never, ever, 100% prove someone
Re: (Score:2)
And as long as you didn't fit the CCTV footage, have a record for that type of crime, find it hard to show evidence of the spraying, had a remotely plausible alibi, leave any DNA or fingerprint evidence at the site etc I'm sure you might have a chance with that defence.
You mean criminals have a hard time finding a single friend who owns any kind of spraying bottle and a hooded sweatshirt?
Re: (Score:2)
Re: (Score:2)
So it's even better? (Score:3, Interesting)
So it's even better?
Just as I was reading that story, I was thinking, "WTF, why McDonald?" I mean in retail the majority of thefts are by employees, not some guy charging in to snatch a plastic cup and run.
So now you just need to figure how to trip the spray on some lone guy who came for a burger at 2 AM, pocket a thousand and claim he robbed you. Or you can get even more creative if the miracle bottle that the PHB marks everything with is easily accessible by just, say, opening his desk drawer.
Thanks to id
Re:Water? (Score:5, Interesting)
Are you sure it was only issued to company X? Show my evidence that no other bottle could possibly contain the same solution. See, with humans this process occurs naturally, everyone has different DNA (with extremely high probability) because of how biology works. Once you start making your own, you've shown that it's possible to duplicate DNA, thus the solution is NOT necessarily unique.
"I also know from experience that a 50ml pot of SmartWater is enough to chemically mark every PC or electrical item in a school several times a year and last several years."
So, you have now just told us that you have the ability to put the SAME SOLUTION on multiple DIFFERENT ENTITIES MULTIPLE TIMES PER YER for years on end. Thus, anyone could, with only a tiny amount of this stuff, frame any number of different people with extreme ease.
"but with SmartWater once it's in police possession even the smallest tiny speck of SmartWater (which can be deployed even on hard-to-cleanse areas like across the PCB's of (unpowered) motherboards) or similar will link it to it's owner."
No, it will link it to whoever managed to get their hands on one of these bottles and spray it on whatever the fuck they felt like. I could go mark every computer at my local university with this stuff and then claim that the entire computer lab belonged to me because only I have this bottle of magic property-identifying liquid.
Re: (Score:2)
This is not the same DNA as you are made of. It doesn't behave the same way.
This is not evidence all on its own, it's used to further investigation.
Really? (Score:2)
Really? What other kinds of DNA are there? And shouldn't that raise more questions that for normal DNA we already know the answers, but which a new technology would have still unclear?
That's exactly what some of us hope, but I'd say it's not a given. Really, look just in this thread how many people take it for some kind of magical marker that can't possibly be w
Re: (Score:2)
Re: (Score:3, Insightful)
Just think of it as a marker that contains a guaranteed unique identifier. backed up by a system that records which company is associated with that uniique identifier, and records to prove that they were the only company who has access to that identifier.
Many people have already pointed this out here, but since apparently it is too hard for you to understand I'll point it out again: no system of identification is more secure than its weakest link. In the case of SmartWater and other similar systems, the weakest link is the end user. Unless you can prove beyond reasonable doubt that no one in the shop in question has had any access to the source bottle, and you can further prove that no one who has been sprayed has ever transfered any of the material to a
Re: (Score:2)
You accept a company's guarantee to behave in a certain way from your bank, you expect your legal system to behave in a certain way.
You expect the company that produces any pharmaceuticals you take to make certain guarantees as to quality, testing, efficacy and manufacture.
It's a forensic tool. Company X will certify that smartwater product ID 12345678abc was manufactured on a set date, track its packaging and dispatch to a specific customer, and then retain their recor
Re: (Score:2)
Nobody except you is claiming it is an "auto win" button for crime and property recovery.
You spraying someone elses property is stupid because you don't have chain of evidence indicating you legally own said property.
It is the combination of property records + marking liquid + company w/ high level of trust (if smart water company trust is worthless so is the product) that increases likelihood of recovery.
Sometimes it isn't even about criminal charges. Stolen property ends up in pawn shops all the time mis
Re: (Score:2)
""How did you come to have a UV marker solution on the clothes you wore last night that is ONLY issued to Company X" Are you sure it was only issued to company X? Show my evidence that no other bottle could possibly contain the same solution. See, with humans this process occurs naturally, everyone has different DNA (with extremely high probability) because of how biology works. Once you start making your own, you've shown that it's possible to duplicate DNA, thus the solution is NOT necessarily unique.
It's fairly trivial to synthesize a chunk of DNA that is extremely unlikely to be natural: a couple kilobases of repeated GGGTTTCCCAAAGGGTTTCCCAAA is as unlikely to appear in nature as a monkey typing a couple kilobytes of Shakespeare. Of course it's *possible*, just as it's *possible* that someone else out there has exactly the same fingerprints as you do and that person was the one who left the fingerprints at the scene, but this is why we invented statistics.
Add to that huge long repeating sequence, a
Re: (Score:2)
Of everything. Because this is a fine mist that will stick to everything, even your hands, shoes, clothes, socks, the bag,
Well, any store that wants me to come home with their mist can go fuck themselves. Hopefully they'll make it mandatory to warn about that crap being in the air at least.
Re: (Score:2)
Similar technology is used by dogs to mark they trees they own in the park.
Re: (Score:2)
I've used a similar competing product called SmartWater.
The beauty of things like SmartWater is that its a suspension of fine molecules that can be *uniquely* identified to a particular user (i.e. you get a coded bottle with a unique number and a unique solution). The UV is just there to light up when people go through police stations but the chemical itself is, supposedly, uniquely identifiable.
You mean this [glaceau.com] smartwater? Wow, i had no idea flavoured vitamin water could do such things! And i thought it was to make you smart...
Re: (Score:2)
Re: (Score:2)
Why would it mask it? You'd just have two different markers on you, that's all.
Re: (Score:2)
Given my contact with UK police officers (specifically London ones) in terms of security marking:
I was warned never to go into a police station soon after I'd done the marking because I *WOULD* be pulled as they have UV lights in reception (where they deal with ordinary queries) for just this purpose and I was lighting up like a Christmas tree. They get them as they enter the building. They even stopped the guy who works for the company because the same thing happened when he walked into a station to demo
Re: (Score:2)
Once it dries, it doesn't spread like you seem to think.
Re: (Score:2)
'If the Brits really wanted to be tough on crime they would take people's DNA before an offense is committed, and then analyze said DNA to determine if it has any crime genes in it.'
Recent research has shown that the vast majority of criminals carry a single copy of the SRY gene:
http://en.wikipedia.org/wiki/SRY [wikipedia.org]
but less than half of people in the general UK population do! We should round up these 'SRY carriers' before they can do any more damage, and re-direct their anti-social tendencies into alternative ac
Re: (Score:2)
We should round up these 'SRY carriers' before they can do any more damage, and re-direct their anti-social tendencies into alternative activities that may still be obnoxious, but should be relatively harmless
We already do. "Televised professional sports".
Re: (Score:2)
Of course it's not good enough. I could say that I saw you steal my car, you certainly wouldn't want to be arrested based on that, would you?
The question is, why didn't you go ahead with the super soaker idea? Sounds like it would actually work. If nothing else, it would keep them from coming back.
Re: (Score:2)
Alas, if he went ahead with this idea, the only thing that would be provable was that he engaged in assault (by squirting the kids) and destruction of property (by ruining their clothes with dye). And the culprits likely know this, and being familiar with the justice system, probably know how to pursue a charge.
People in the UK have been afraid to defend themselves and their property for years because they perceive that the law is on the side of the criminal in such matters.
Re: (Score:2)
People in the UK have been afraid to defend themselves and their property for years because they perceive that the law is on the side of the criminal in such matters
Perceive? Gimme a break - it flat out is. Persistent offenders keep getting given community sentences and never see jail time. How can you get to 50 separate convictions without spending life in jail?
And yet more and more people are arrested for assault for defending themselves. Sure, mostly the charges are eventually dropped, but in many cases
Re: (Score:2)
How about... (Score:2)
--TSP