Catch up on stories from the past week (and beyond) at the Slashdot story archive

 


Forgot your password?
Close
typodupeerror
×
Biotech Media Music

DNA-Radio, Tune In To Your Chromosomes 77

Posted by samzenpus from the because-we-can dept.
An anonymous reader writes "The folks behind the DNA-Rainbow project (discussed on Slashdot before) apparently have some time to play around with genome data. After creating amazing pictures from the human DNA code they are now transforming all chromosomes to audio and streaming them to the Internet. Every base is read and broadcasted instead converting it to a color. Seemingly this artistic project will last a while. After some math they found out that it will take them more than 23.5 years to air the whole human genome sequence."
This discussion has been archived. No new comments can be posted.

DNA-Radio, Tune In To Your Chromosomes More

DNA-Radio, Tune In To Your Chromosomes

Comments Filter:

  • CCCCCAGCAAGCCCA (Score:4, Funny)

    by Praedon ( 707326 ) on Wednesday March 04, 2009 @10:51PM (#27073603) Journal
    I for one welcome our robotic chromosome reader overlord. Cause it's going to know everything about our DNA, so it's important to n... CCCCCCAAGGCCCCAACCCAAAACCCCGGCCGGTCCATTCAA

    • Re:CCCCCAGCAAGCCCA (Score:5, Interesting)

      by !coward ( 168942 ) on Wednesday March 04, 2009 @11:04PM (#27073683)

      I was actually a little disappointed when I heard the feed.. Hadn't expected it to be just a robotic reader spelling out the sequence.

      Thought they might have just used the fact that three of the bases start with letters that are also musical notes in the english notation (A, C and G).. Choose a suitable 4th note for Thymine (maybe E, its last letter) and then run it through a midi sampler..

      To spice it up, they could do some fun stuff with combinations, for example altering the tempo when you found repetitions of the same base, something for sharp/flat (just to mix it up a bit), etc..

      Maybe not the point of this experiment (well, if you can call it that -- this isn't exactly science anyway), but as with the previous graphics experiment, it might even produce some interesting tune somewhere down the line.

      As it is, though a nice code hack I'm sure, the result is a tad boring.

      • I was expecting something like C= note C. A= note A. G= note G. T= note B or E or D.

        Sounds retarded when it's a voice going C C C C A G T C C C C C T C C C C G G G G G G blah blah blah

      • Re: (Score:2)

        by Mal-2 ( 675116 )

        It could be interesting to play all three members of each base triplet simultaneously, in three different octaves, one "chord" after another. This might even help researchers listen for specific amino acid combinations, which some people might find easier than reading row upon row of CCATGCCAAGAT.

        The triplets might also be translated into different chords not directly related to the A minor 7 chord (A C E G). This would help when two bases of a triplet are the same, as it is generally more difficult to hear

        • One things a given. Any of your sugestions would certainly have been more interesting than something that sounds like my telephone companies help desk.

      • Re: (Score:2)

        by Samah ( 729132 )
        Steve Vai released a limited edition "DNA" model guitar with his DNA as the paint job. Now that is extreme epic win.
        http://www.vai.com/Machines/guitarpages/guitar117.html [vai.com]
      • Who else would download it?

      • Re: (Score:2)

        by sorak ( 246725 )

        Maybe not the point of this experiment (well, if you can call it that -- this isn't exactly science anyway), but as with the previous graphics experiment, it might even produce some interesting tune somewhere down the line.

        That would be awesome. If they have enough data to broadcast for decades, then it is likely that something would appear during that time.

        I wouldn't want to have to argue with the people who say "year 12, month 2, day 7, 7:31:59am sounded kinda like Beethoven for thirty seconds, only god could make that happen", but it would still be interesting to see the patterns that must be there.

    • Re: (Score:3, Funny)

      by gravos ( 912628 )
      Your comments are pure CACA you GAT! You have as much TACT and a rubber CAT with a GATTACA TAT.
    • We're lucky the scientists were creative with the ACGT thingy.

      I would've hated listening to ABBA for 23.5 years.

  • Nice. (Score:4, Insightful)

    by Creepy Crawler ( 680178 ) on Wednesday March 04, 2009 @10:52PM (#27073613)

    So now, YOUR dna isnt just covered be somebody else's patents, but now your DNA is someone else's copyrights.

    • That wasnt supposed to be funny.

      This is the result when one attempts to "reform patents", as we see in a prior article. Remember that patents only have a life of around 17 years. Copyright is, what, 150 years or so, if owned by a corporation. If the corps cant own it via patents, they'll own it via copyright. It's simply the Tragedy of the Anticommons., and was guessed if patent rights were, or perceived to be weakened.

      -- a poem from the opening of Distress, by Greg Egan

      It is not true that the map of freed

    • Re:Nice. (Score:5, Funny)

      by dwywit ( 1109409 ) on Wednesday March 04, 2009 @11:11PM (#27073735)
      Hence - all your base are belong to us!

    • Re: (Score:2)

      by keeboo ( 724305 )
      Hmm... Imagine the possibilities:

      Like, a couple want to have kids, but they have to pay for a "DNA combination license" prior to the conception.
      Since sex carries the risk of conception, even non-conceptive sex will need a proper authorization and a ID (specifying, among other things, sexual orientation). Gay people don't like that and say it does not apply to them, but so is the law.

      Parents would not only worry with feeding, paying school etc. There will be a regular tax which would go to a R

  • Douglas Adams (Score:4, Informative)

    by GrahamCox ( 741991 ) on Wednesday March 04, 2009 @10:55PM (#27073635) Homepage
    Douglas Adams (also DNA) used this idea in one of the Dirk Gently books - turning arbitrary data into beautiful audio. Then again he may have nicked it from Brian Eno, who was also talking about something similar in the 70s.

    • Re:Douglas Adams (Score:4, Informative)

      by v1 ( 525388 ) on Wednesday March 04, 2009 @10:58PM (#27073647) Homepage Journal

      I was hoping they'd be playing some sort of music created from the sequences. listening to some monotone voice recite letters of the alphabet ad-nausium isn't going to attract anyone

      • Re:Douglas Adams (Score:4, Informative)

        by clang_jangle ( 975789 ) on Wednesday March 04, 2009 @11:06PM (#27073691) Journal
        Agreed, it's very disappointing. I guess samzenpus calling it an "artistic project" in TFS set me up to expect more. Wonder if he actually lisened to it? Here's a direct link [dna-rainbow.org] to the stream, for sam and whomever else wants to hear.

      • Re:Douglas Adams (Score:4, Informative)

        by Amouth ( 879122 ) on Wednesday March 04, 2009 @11:07PM (#27073697)

        to be honest i was thinking the same thing.. after seeng some of the patterns in the image versions i was wondering if they where going to take either the individual pairs and match them with and instrament or have one modify the other or something - kinda like the network analyser that turns logs and box loads into clasical music..

        if they did that and it was remotely nice to listen to.. i would have it book marked - but after 30seconds of that thing i will never touch it again except maybe to troll someone

    • John Cage wasn't just talking about it, he was doing it (including radios and other aleatory elements in his performances) back in the 1940s.

  • "After some math they found out that it will take them more than 23.5 years to air the whole human genome sequence."

    And yet it'll still be torrented.

  • It is actually just some kid with a broken Speak & Spell.

    • Re: (Score:2)

      by Kozz ( 7764 )

      It's not broken. It's been given to a two-year-old. Parents of two-year-olds can back me up on this one.

      ("would you please stop pushing that same f@%*#&$ button!?")

  • The Shamen [wikipedia.org] did this with their song S2 Translation [nemeton.com] almost 15 years ago. Granted, it was a segment of a protein instead of the full genome, but it sure sounded better [www.last.fm].
    • Hey, I even know the guy who worked with the Shamen on this [aber.ac.uk]. He would probably agree with me that "DNA music" is never going to be more than a gimmick (although there's probably a huge market for it in the magnet/crystal/copper pendant brigade).

      Now, what is much much more interesting is proper evolutionary music, like my recently released (on Darwin Day, of course) site which has four channels of real time streaming evolving electronica. The link's in the sig...

  • I don't get it... (Score:3, Insightful)

    by iluvcapra ( 782887 ) on Thursday March 05, 2009 @12:04AM (#27074023)

    It sounds like a numbers station, but at that it's still not very useful.

    The problem with this and DNA-rainbow is that it doesn't transform the domain of the raw base pairs into a domain of human vision (or audition) in such a way that actual higher-order patterns occur. We take long strings of tabular numbers that have no pattern at all and transform it into a beautiful curve, and this gives us insight into what the numbers may mean, what they may do in the future, etc. But this stuff adds nothing to the noisy junk it's built on... imho

    • Yeah, a higher order audio signal could be constructed, and that 23.5 years could be greatly reduced.

      I wonder, if mapping DNA to more a complex audio signal, what's the shortest signal (or "song") that could be produced, such that the song is both pleasant and distinct (to human ears) for each DNA sequence? I wonder if people would have a natural tendency to enjoy such a song based on their own DNA.

      But of course, that's silly. DNA doesn't sequence songs, it sequences people. Ahhh... the song of life. :)

  • Numbers Station (Score:3, Interesting)

    by Penguinshit ( 591885 ) on Thursday March 05, 2009 @12:06AM (#27074043) Homepage Journal
    It's the ultimate numbers station! [wikipedia.org]

  • like it's a radio show, then woulld you be a "freak show"?

  • Just as interesting as looking at the base pairs... which isn't very. Someone needs to put this into Songsmith somehow.
  • Karma be damned! That was hella lame. I want my 12 seconds back.

  • DNA to Sound (Score:2, Informative)

    by PoolOfThought ( 1492445 )
    I did a dna to sound project as a graduate student that actually played notes for a given chromosome. In fact I created an entire virtual orchestra (multiple machines) that were able to sync up and play from the same piece of sheet music (DNA). I don't remember exactly how I encoded the notes (If I recall the user was able to (1) select how many alleles should be in a note (2) the program would then break a given strand up according to the value entered (3) the user would choose the frequency to apply to ea
    • I'll be darned. I actually found the source code for the "dna sonification project". It turns out it was INTENDED to be a "dna" program, but it will allow any string... for example it could play the text on slashdot as "music".

      I'm not sure it isn't an early version (some debugging message boxes occasionally pop up) but it works once the libraries are installed. If anyone is interested let me know... I'll gladly provide the JAVA source code and other libraries as I'm not doing much with it these days othe

  • So, as the project itself is so boring and uninspired...

    BROADCASTED?!
    Please don't tell me people have actually started using that. The word is BROADCAST.
    The sounds will be broadcast, the sounds are being broadcast, the sounds WERE broadcast.
    There is no past tense for that word.

    • Re: (Score:2)

      by bumby ( 589283 )
      (double)spike1
      I typecasted you!
    • New Scientist has a good article on the changing nature of English language. One of the trends is to reduce the variability in non-standard verbs. ie make all verbs work the same way. "Run" will become "runned" on day. The trend starts with big words that people dont know well or dont know the rules for... like broadcast. Change is coming!!!

      • Re: (Score:2)

        by spike1 ( 675478 )

        Change which I will resist to my last breath.
        Education is what's needed, not bowing to the ignorant.

  • When Ballmer's DNA was fed in all that was heard was "developers, developers, developers"

    We don't know what Gates' DNA sounded like because it opened up a gateway to hell that swallowed everybody in the room.

  • This has been done before, but in the way that we all expected.

    http://whozoo.org/mac/Music/samples.htm [whozoo.org]

    These make good background music while I'm working. And I'm really fascinated by the fact that I even mildly enjoy music that wasn't written by a human being.

  • premise of Species movies (Score:3, Informative)

    by peter303 ( 12292 ) on Thursday March 05, 2009 @12:14PM (#27079105)
    Scientist implant DNA sequence downloaded by SETI. They didnt understand it, but it turns out to be BAD. Thats how the evil aliens propagate themselves.
  • Now the aliens can create a slave race of humans without even having to travel here to kidnap any! ;-)

Slashdot Top Deals

A CONS is an object which cares. -- Bernie Greenberg.

Close