Forgot your password?
typodupeerror
Biotech Announcements Science

Fluorescent Protein Research Lands Scientists Nobel Prize 79

Iddo Genuth writes "The Royal Swedish Academy of Sciences has announced three recipients of the Nobel Prize in Chemistry award for 2008: jointly given to Osamu Shimomura, Martin Chalfie and Roger Y. Tsien 'for the discovery and development of the green fluorescent protein, GFP' — a remarkable brightly glowing green fluorescent protein first observed in the beautiful jellyfish, Aequorea victoria, in 1962."
This discussion has been archived. No new comments can be posted.

Fluorescent Protein Research Lands Scientists Nobel Prize

Comments Filter:
  • I thought my BBQ sauce was going to win the Nobel Prize for Chemistry :(
  • The committee gave them a glowing recommendation....

    They must be glowing with happiness.... .....

  • These guys gave us the frabjous green pigs [google.com], for which all Dr Seuss fans should be quite thankful.

    But more seriously, the GFP gene is amazingly useful in genetic research. Personally I would have given them the Nobel in Biology rather than Chemistry.

    • Re: (Score:3, Interesting)

      by Markspark ( 969445 )
      yeah.. me too, so i started looking, and a lot of the guys who received nobel prices in physics, got it for discoveries i for one consider chemistry.. such as Rayleigh, Pauli, and some others.
      so i guess it evens out, and besides, there's no price for biologists. and as some wise cartoonist once put it, Biology is just applied physics http://xkcd.com/435/ [xkcd.com]
      • Re: (Score:3, Insightful)

        by ceoyoyo ( 59147 )

        When Nobel was creating the prizes biology had more in common with being a librarian than it did with what we think of as biology today.

      • Re: (Score:2, Funny)

        so i guess it evens out, and besides, there's no price for biologists

        Cool! Biologists are free as in beer! Can I have 10, please? Oh, and can you make them female? And cute, too.

    • Re: (Score:1, Insightful)

      by Anonymous Coward

      First, there is no Nobel Prize for biology. The closest related fields are "chemistry" and "physiology or medicine."

      Second, it is truly sad that a relatively trivial technique, rather than a grand idea or discovery is awarded the Nobel Prize. The Prize should be given to those who actually advance the knowledge of the field and provide a breakthrough that leaves us all gaping in amazement, not the engineers that build the tools to do the investigations. It is an unfortunate commentary on how trivial rese

      • Re: (Score:1, Informative)

        by Anonymous Coward

        Relatively trivial? Tsien's work on expanding the spectra at which fluorescent proteins emit has been anything but. He and his lab pretty much figured out the chemistry by which normally non-fluorescent amino acids are modified post-translationally (after the protein has been made inside the cell) to create a chain of conjugated Pi electrons (ie several double bonds one after the other). This had never been seen in other proteins. Then he took the backbone of the protein and modified the amino acid sequ

    • by reverseengineer ( 580922 ) on Wednesday October 08, 2008 @04:14PM (#25304909)
      The issue is that there is no Nobel in Biology- there are Nobels in Chemistry and in Physiology or Medicine. While there have been some fascinating experiments using GFP to illuminate (sorry) processes in human cells, what these three did probably is not best categorized as a medical advance. It's been pretty common practice, especially in the last couple decades, to consider advances in biochemistry/molecular biology as eligible for the Nobel in Chemistry.
      • by Hatta ( 162192 )

        It's been pretty common practice, especially in the last couple decades, to consider advances in biochemistry/molecular biology as eligible for the Nobel in Chemistry.

        Which is a good way to approach it, considering that chemistry is mostly solved anyway. Pretty much anything that would be worthy of a Nobel in chemistry would be equally or better suited for a Nobel in physics.

        • Re: (Score:3, Informative)

          I wouldn't go quite that far, at least not yet. Looking at the last ten Chemistry Nobels, it's about 50-50 between molecular biology and the rest of chemistry. Last year's prize went for work in surface catalysis, 2005 went to the olefin metathesis guys, 2001 was for chiral syntheses, 2000 was for conductive polymers, 1999 was for femtosecond kinetics, and 1998 was for quantum chemistry.

          I'll grant that chemistry doesn't have the big questions to solve like physics does, but there are still substantial d

  • any green glowing food coming for halloween?

    • by HTH NE1 ( 675604 )

      any green glowing food coming for halloween?

      Gummy Bears under blacklights?

      • GFP is a protein, gummy bears on the other hand are completely inorganic goo.

        • by HTH NE1 ( 675604 )

          GFP is a protein, gummy bears on the other hand are completely inorganic goo.

          They're a gelatinous suspension of sugar. As you saying sugar is inorganic?

          (Actually, in most US states they're probably high fructose corn syrup.)

          • Re: (Score:3, Interesting)

            by idontgno ( 624372 )
            More to the point, they're gelatinous because they're made of gelatin. Which is protein.

            So substitute GFP for boiled animal joints et voila phosphorescent gummis.

            • woooooosh. Didn't realize there were so many fans of gummy bears!

              Gellatin is used probably because when you boil it it becomes denatured and can bind with other mollecules to make a net, similar to albumin from eggs. GFP can denature too, but that destroys it's structure and fluroescence. I'm not sure it would congeal the same, but it wouldn't still glow.

      • Tried that, nix. So far I haven't found a brand of candy that glows under UV.
        • by HTH NE1 ( 675604 )

          Tried that, nix. So far I haven't found a brand of candy that glows under UV.

          Darn. Would have been good, especially for Gummy Worms.

          Have you checked SweetTarts Sours or other sour candies? That outer sour coating might twinkle.

          I guess for glowing under UV you'll need something with a UV-reactive wrapper.

          • One way to make Jello glow is to embed glow sticks or glow bracelets into to. You do have to be careful that drunk party goers don't eat the glowing part though...
    • any green glowing food coming for halloween?

      maybe not... but you could be putting a GFP fish [google.com.au] under a glowing Xmas tree [google.com.au] (not GFP, but still cool)

    • I've been on a hunt for fluorescent food for several years now. So far, beer is the only edible substance that I've found that even weakly glows. There are dyes that are listed as fluorescent and non-toxic, but it's a stretch from non-toxic to edible. B.T.W. I theorized the it was the Vitamin B in beer that made it glow, but I tried several brands of vitamin B (multi and single versions like B12) and non of them glowed under UV.
  • Um... tasty.
  • there was obviously prior art - even sited. And they still got the prize. I kid...though sounds familiar.
    • Well, they didn't patent the GFP mollecule. I think Tsien may have patented some derivatives that he developed which aren't found in nature, but the original GFP is not.

  • by sgt scrub ( 869860 ) <saintium AT yahoo DOT com> on Wednesday October 08, 2008 @04:51PM (#25305381)

    Hold onto the cash until they successfully splice it into the mosquito's DNA. Glowing mosquito == dead mosquito!

  • Glofish (Score:3, Interesting)

    by PoitNarf ( 160194 ) on Wednesday October 08, 2008 @05:13PM (#25305659)
    I think this is the same protein used in Glofish:
    http://en.wikipedia.org/wiki/GloFish [wikipedia.org]

    Got some here in our tank at work, they're pretty cool to look at.
  • Some 36 years ago, in another life as a physiologist, I used this protein, also known as Aquorin as an means to monitor the rise and fall of the intracellular calcium ion concentrations in invertebrate muscle. Aquorin fluoresces in the presence of very low levels of calcium ions and was used as one of the means to show that these ions were responsible for triggering muscle contraction. However, the experiments were very difficult to do, Aquorin was very expensive and the success rate of the experiments wa

  • Now let's see them insert the gene into a chameleon and see what it'll do...

  • Can I swallow GFP to get glow-in-the-dark jizz?

  • Poor link choice? (Score:3, Insightful)

    by Prune ( 557140 ) on Thursday October 09, 2008 @12:09AM (#25309199)
    Why was "beautiful jellyfish" selected as the portion of the text hyperlinking to the article? I clicked on it expecting to see a beautiful jellyfish, and instead saw three humans that are not quite beautiful...
  • In case anyone wants the GFP sequence: atggtgagcaagggcgaggagctgttcaccggggtgg tgcccatcctggtcgagctggacggcgacgtgaacgg ccacaagttcagcgtgtccggcgagggcgagggcgat gccacctacggcaagctgaccctgaagttcatctgca ccaccggcaagctgcccgtgccctggcccaccctcgt gaccaccctgacctacggcgtgcagtgcttcagccgc taccccgaccacatgaagcagcacgacttcttcaagt ccgccatgcccgaaggctacgtccaggagcgcaccat cttcttcaaggacgacggcaactacaagacccgcgcc gaggtgaagttcgagggcgacaccctggtgaaccgca tcgagctgaagggcatcgacttcaaggaggacggcaa catcctggggcacaagctggagtacaactacaacagc cacaacgtctatatca
  • by Maximum Prophet ( 716608 ) on Thursday October 09, 2008 @08:56AM (#25312257)
    There was a piece on NPR this morning on the guy, Douglas Prasher, who actually discovered the gene that makes this protein. (The winners came up with a way to use his gene) His funding was cut and he's now driving a courtesy car for a car dealership in Alabama.

Time is nature's way of making sure that everything doesn't happen at once. Space is nature's way of making sure that everything doesn't happen to you.

Working...