Forgot your password?
typodupeerror
Biotech Science

Genome of DNA Pioneer Is Deciphered 142

unchiujar writes "The New York Times reports that the full genome of James D. Watson, one of the discoverers of the structure of DNA in 1953, has been deciphered, marking what some scientists believe is the gateway to an impending era of personalized genomic medicine. A copy of his genome, recorded on a pair of DVDs, was presented to Dr. Watson on Thursday in a ceremony in Houston by Richard Gibbs, director of the Human Genome Sequencing Center at the Baylor College of Medicine, and by Jonathan Rothberg, founder of the company 454 Life Sciences. 'The first two genome sequences belonging to individuals are now being made available to researchers within a few days of each other. One is Dr. Watson's and the other belongs to J. Craig Venter, who as president of the Celera Corporation started a human genome project in competition with the government. Dr. Venter left Celera after producing only a draft version of a genome, his own, in 2001, which the company did no further work on. He has now brought his genome to completion at his own institute in Rockville, Md., and deposited it last week in GenBank, a public DNA database, he said.'"
This discussion has been archived. No new comments can be posted.

Genome of DNA Pioneer Is Deciphered

Comments Filter:
  • by Anonymous Coward
    In reality, they just sequenced his clone!
  • by BrunoBigfoot ( 996441 ) on Friday June 01, 2007 @11:06PM (#19360523)
    Torrent pls?
    • by CharlesEGrant ( 465919 ) on Friday June 01, 2007 @11:55PM (#19360713)
      It's not a torrent, but you can in fact download the complete sequence and traces [nih.gov].
      • >gnl|ti|1741299339 name:1094373133425 mate:1742401149
        gttgaaatgggacgttgatggggtgatgtctgttcagtcttcgctgttta aaaagtttgggttatttttattgtgaaactgttggggttttctgcacatt ctctagatacaagacccttaccagatttatgtgtgggagtatcccaccca ttctgaattgtgtccctttgtcttcctcatggtgtgcttaatcgttattt aacacttaaccatttttttatggctagtgcttttagccataaagtcctaa gaaatcttttcctacctcaaggtgacaaagatactctcctctgttctatt tttcatttttatattgtacacaacacttaaaaaataagtctaagtgttac tagctgagaaataccagaaaacaacttgcataaatgctgaaatcgaattg ctacccctattttggattgaaatgaatttgaagggggaagaatgtca
        • Re: (Score:3, Insightful)

          by Dunbal ( 464142 )
          Anyone know if combination restrictions apply?

                Yes, but most of them are not compatible with life, so chances are you don't have any.
        • Re: (Score:2, Funny)

          by Smight ( 1099639 )
          I would assume that combinations which result in your brain being outside of your body or having five lungs and the liver of a titmouse, would be a pretty strong restriction.
        • Re: (Score:2, Funny)

          by Anonymous Coward
          >gnl|ti|1741299339 name:1094373133425 mate:1742401149
          gttgaaatgggacgttgatggggtgatgtctgttcagtcttcgctgttt a aaaagtttgggttatttttattgtgaaactgttggggttttctgcacatt ctctagatacaagacccttaccagatttatgtgtgggagtatcccaccca ttctgaattgtgtccctttgtcttcctcatggtgtgcttaatcgttattt aacacttaaccatttttttatggctagtgcttttagccataaagtcctaa gaaatcttttcctacctcaaggtgacaaagatactctcctctgttctatt tttcatttttatattgtacacaacacttaaaaaataagtctaagtgttac tagctgagaaataccagaaaacaacttgcataaatgctgaaatcgaattg ctacccctattttggattgaaatgaatttgaagggggaag
  • completely torn (Score:3, Interesting)

    by farkus888 ( 1103903 ) on Friday June 01, 2007 @11:15PM (#19360567)
    this is really really cool for obvious reasons. it's also really really scary for equally obvious reasons. if I wasn't so afraid of the potential harm of misusing this power I'd sign my name now to be the third person done.
    • Re:completely torn (Score:4, Interesting)

      by kestasjk ( 933987 ) on Saturday June 02, 2007 @01:40AM (#19361193) Homepage
      Why is it scary?
      • If someone wanted your DNA for malicious purposes would they have any trouble getting it? Unless you're meticulous about security and burn all your trash, it'd be no problem.
      • What could they do with your DNA?
        • Trace you back to crimes? They can do that already by taking your DNA without consent.
        • Clone you? Nope, not yet at least, and what would they do with the clones?
        • Discover you have the "criminal gene"? These "criminal/musician/pedophile/libertarian/democrat" genes are nonsense.
      • My cousin did genetics at Oxford and, iirc, his professor told him that genetics wouldn't be useful for much in a long time, even to do good.
      The scariest thing I can think of is having a national database of all genetic profiles, as it could have privacy implications. But that would be no scarier than having a national database of all fingerprints (but much more expensive).
      • I am concerned about people wanting to make decisions about who's life is more important than whose based on genetic dispositions to certain health issues. I don't think I should be passed up for a liver transplant from years of hard drinking because I have a genetic predisposition to parkinsons or diabetes.
        • Re: (Score:1, Insightful)

          by Anonymous Coward
          I don't think I should be passed up for a liver transplant from years of hard drinking because I have a genetic predisposition to parkinsons or diabetes.

          I would deny you the liver implant based solely on your hard drinking. All unlucky souls that need a new liver because of a disease should get it before you who knowingly killed your own liver get a new.
      • IAAG (I am a geneticist, and a bioinformatician, too), and knowing your complete sequence does give us lots of interesting info about your susceptibility of many genes.

        One thing you (and that's the slashdot you) know is that in the last few years we've had a moore's law ^2 increase in the amount of data we're gathering and analyzing. This is leading us to a huge increase in our understanding of humans and disease. 5 years ago, it was a pipe dream (or a million dollar project) to do a complete genome scan
    • Re: (Score:2, Interesting)

      by MikShapi ( 681808 )
      Harm? And I thought all the "Be scared of Hitler Clones" has subsided.

      Dude, if we mastered electricity, nuclear technology, chemistry, biological warfare and millions of 1+ ton hunks of metal whizzing around at 100km/h all over the the planet's surface, and made humanity benefit from all the above, do you REALLY think personalized medicine as a consequence of knowing your personal genome would do more bad than good to warrant "being afraid of the technology"?

      Gimme a break. 1978 called, they want their hitle
    • by Wolfrider ( 856 )
      --They gave it to him on (2) DVD's. Couldn't they have just burned it to a dual-layer?
      :b
  • by Anonymous Coward on Friday June 01, 2007 @11:21PM (#19360595)
    For the curious, read a pretty good synopsis of Dr. Watson here: http://en.wikipedia.org/wiki/James_D._Watson#Contr oversy_about_using_King.27s_College_London.27s_res ults [wikipedia.org], and if you are extremely interested, pick up a copy of "The Double Helix." It is really strange, but even his autobiography makes him sound like a total ass, and includes an apology of sorts in the revised version, which is commendable.

    In short, Watson stole a lot of data, and the structure of DNA would have been determined in less than a couple months by the more deserving Linus Pauling, who has conducted himself in a much more dignified fashion. It is really strange how superficial history records events, with the "first" often the most noisy, obnoxious scientist / engineer / artist, and not the industrious, studious type.

    Well, perhaps they will find some genes responsible for the "jerk" phenotype... (at work, have to post AC).
    • Re: (Score:2, Funny)

      by mythar ( 1085839 )
      it's okay, linus. we appreciate your input.
    • by WIAKywbfatw ( 307557 ) on Saturday June 02, 2007 @12:01AM (#19360747) Journal
      Yes, the man was part of a team that made a huge scientific breakthrough. If someone wants to argue that that makes him a genius, well, I won't start an argument on that front. But there's no doubt that Watson was (and still is) also of poor character.

      He and his colleagues knowingly stole vital DNA X-ray diffraction data from Rosalind Franklin and Raymond Gosling without their knowledge and consent (indeed, Franklin had even refused to share it), which tarnishes their acheivements.

      More recently, he has called for genetic screenings before birth to weed out "really stupid" people (the bottom 10 percent or so), and he has a nice line in how to deal with homosexuality, too. He believes "that if the gene [for homosexuality] were discovered and a woman decided not to give birth to a child that may have a tendency to become homosexual, she should be able to abort the fetus." Not to put too fine a point on it, but that strikes me as being rather too close to Third Reich thinking for my liking.

      He might have performed some fantastic science but, to me, his words preclude him from being considered a great scientist. Certainly they show that he's not a great human being.
      • More recently, he has called for genetic screenings before birth to weed out "really stupid" people (the bottom 10 percent or so), and he has a nice line in how to deal with homosexuality, too. He believes "that if the gene [for homosexuality] were discovered and a woman decided not to give birth to a child that may have a tendency to become homosexual, she should be able to abort the fetus." Not to put too fine a point on it, but that strikes me as being rather too close to Third Reich thinking for my liki

        • Re: (Score:3, Informative)

          by WIAKywbfatw ( 307557 )
          No. Sorry, you've got me wrong here, friend. It's not a case of "anything that looks like what the Nazis did is bad", it's a case of what he said isbad.

          Abortions because of a likelyhood of low IQ or homosexuality? That doesn't abhor you? I'm all for a woman's right to choose not to have a baby (it's her body, it's her choice) but to make that choice available on the basis of likely intelligence or sexuality (or hair colour, or skin tone) is, to me and most people, a step too far.

          OK, if a foetus is going to
          • If it wasn't such a serious issue, watching pro-abortion people try to justify their position would be funny.

            Its not a baby or not a human life so its okay to kill it... unless your reason for killing it is wrong because then it is a human life.

            If abortion hadn't gotten tied into religion, then everyone with a high school education would accept that on simple biological grounds a fetus is a human life. Claiming otherwise is burying your head in the sand as much as the creationism people.
            • There is, in fact, a difference between those cases.

              Abortion is rarely chosen due to features of the baby. It's generally because of the mother's situation in one way or another.

              Eugenics, on the other hand, is based entirely on the baby. It puts people in the position of being able to choose "good" features, and have a "proper" baby. This is dangerous on several levels, potential prejudices in both directions and gene pool reduction being two of the more important ones.

              The fact that a fetus is being destroy
              • This is dangerous on several levels, potential prejudices in both directions and gene pool reduction being two of the more important ones.

                The makeup of the human gene pool is being influenced by human choices all the time. Women chose genetic characteristics for their children by selecting the father. Sure, there's the horror story of the human race losing the gene for red hair because it became unfashionable - or more relevently, losing the gene for sickle-cell anemia because it's usually harmful - but A.

              • by sanman2 ( 928866 )

                >The fact that a fetus is being destroyed is not, in my opinion, the part that makes eugenics nasty. The part that makes eugenics nasty is what it means for the remaining children.

                What does it mean for the remaining children? They were the ones who didn't have the undesirable characteristics, remember?

                Look, caring for a severely mentally impaired child can be a real drain on the family. Remember that case of the parents who wanted their young daughter's ovaries removed and her growth stunted, becau

              • by sanman2 ( 928866 )
                And another thing -- most abortions are done in the first few weeks of the pregnancy. The foetus isn't even big enough to fill a tablespoon at that point. There isn't even any significant brain development. If you're stopped from giving blood because a test determines you have some undesirable viral DNA in your blood at the time, then is that so different than you stopping yourself from having a kid if a test determines there's undesirable DNA in the foetus, which is technically part of the mother anyway at
            • Its not a baby or not a human life so its okay to kill it... unless your reason for killing it is wrong because then it is a human life.

              There is an argument against selective abortions that does not rely on the humanity of the fetus at all. That argument goes like this:
              Allowing people to abort their children based on genetic information is socially unacceptable. That's clearly an opening to human genetic engineering, and genetic manipulation is dangerous and poorly understood. That's the sort of thing tha

            • Re: (Score:3, Insightful)

              If abortion hadn't gotten tied into religion, then everyone with a high school education would accept that on simple biological grounds a fetus is a human life.

              A fetus is excluded from the meaning of the legal term "person", because that's easier to do and results in more consistent application of the law than would amending every single law to replace "person" with "person other than a fetus". For similar reasons, corporations are considered legal "persons".

              The "fetuses aren't people" argument is a red herring, anyway. Yes, a fetus is a human life, and a chimpanzee is almost a human life. However, in our society, we benefit from offering only very limited

              • Re: (Score:3, Interesting)

                by dn15 ( 735502 )

                Frankly, I'd be interested in hearing any sound arguments (beyond "It's just so wrong") that eugenics is bad for the species.

                Disclaimer 1: I don't know much about Eugenics so the following may be totally wrong.
                Disclaimer 2: I know that 28 Weeks Later was just a movie. Bear with me, I just bring it up to illustrate my theory.

                One way Eugenics is potentially bad for the species is that by weeding out undesirable characteristics we reduce genetic diversity. And if diversity decreases and some terrible dise

                • One way Eugenics is potentially bad for the species is that by weeding out undesirable characteristics we reduce genetic diversity. And if diversity decreases and some terrible disease hits the species it might be able to take a bigger bite out of the population.

                  That's exactly why any government mandated or otherwise near-universal social policy that reduces genetic diversity is a bad idea. But... we could easily allow half the population of, say, the United States the choice to abort their fetuses with g

                • So let's say we encountered some similar situation in reality, but we had determined that having differently colored eyes (as an example) is undesirable. It's entirely possible that by eliminating that trait we also wiped out the few people who would have survived the next big plague.

                  Okay. Now let's say that, in your example, people with the differently-coloured eyes become excellent carriers for that plague. If we had wiped out those undesirable genes, the plague would never have taken hold in the first place.

                  More importantly, genetic engineering/selection might ultimately end up being necessary. As various microbes evolve into more drug-resistant forms, we're going to need something to ensure our own survival. Nanotechnology also shows promise, but we still don't really know e

                  • by dn15 ( 735502 )

                    Okay. Now let's say that, in your example, people with the differently-coloured eyes become excellent carriers for that plague. If we had wiped out those undesirable genes, the plague would never have taken hold in the first place.

                    Possibly, but that's not an argument for eliminating some characteristics because we consider them to be less than ideal. Ultimately for the survival of the species, it's less important when something can take hold in a minority if the majority of the population is resistant. Bu

          • Abortions because of a likelyhood of low IQ or homosexuality? That doesn't abhor you? I'm all for a woman's right to choose not to have a baby (it's her body, it's her choice) but to make that choice available on the basis of likely intelligence or sexuality (or hair colour, or skin tone) is, to me and most people, a step too far.

            No, using more information to make an important decision doesn't seem abhorrent to me at all. A pregnant woman has the right to chose to abort the fetus. It's her body, it's her

          • by Tomfrh ( 719891 )
            If it's truly HER body and HER choice, then why should someone else's opinion of her reasons matter at all?
          • but to make that choice ... is, to me and most people, a step too far.

            What, have you done a poll? How many people did you survey, and what's your confidence interval?

      • that if the gene [for homosexuality] were discovered

              This always makes me laugh. An inheritable cause for people who kind of by definition can't (or rather won't) have children. Yeah, homosexuality is a "gene"...
        • by zegota ( 1105649 )
          It's possible. Transmitted through the mother for gay men or the father through lesbians. I'm no geneticist, but I know enough to know that you can't definitively rule out genes having some influence on homosexuality.
          • Re: (Score:2, Flamebait)

            by Dunbal ( 464142 )
            know enough to know that you can't definitively rule out genes having some influence on homosexuality.

                  Yeah, the same argument is used to claim the existence of "God", because you can't "disprove it".

                  I think it is a LOT more likely that homosexuals are so desperate for some sort of justification for their lifestyle to be accepted by society that a "genetic" theory suits them just fine. Aww, it's not THEIR fault. It's a gene.
            • by abigor ( 540274 )
              You don't understand genetics or biology.

              "I think it is a LOT more likely..." Ahh right, there's your problem.
            • considering (Score:3, Informative)

              by ClioCJS ( 264898 )
              considering that the reason species propagate is a sexual attraction to the opposite sex, instilled by biology and thus DNA, it is not a wide leap at all to consider that sometimes the DNA would have a different effect. Like people who have two eyes that are different colors.
            • Actually most of the scientific studies on the subject tend to find that there is a fairly large heritable component to homosexuality. In particular, there have been a number of twin studies that looked at rates of homosexuality in maternal vs fraternal twins that find identical twins (who share 100%) are more likely to both be homosexual than a fraternal twin pair (who only share 50%).
        • by doug141 ( 863552 )
          Don't confuse the last 300,000 years of human society with modern society. The modern standard of expressing a gay gene by "not having children" might not have been an option during the bulk of human evolution.
        • by doug141 ( 863552 )
          Don't confuse the last 300,000 years of human society with modern society. The modern standard of expressing a gay gene by "not having children" might not have been an option during the bulk of human evolution. Especially for lesbians.
        • by vidarh ( 309115 )
          You seem to think evolution can't lead to genes that preclude survival of individuals from becoming widespread, but that's bullshit. Evolution doesn't "care" about individuals - what matters is if the expression of the gene causes a net increase in the odds of someone surviving and passing on their genes than without it.

          If one or more genes lead to homosexuality or increase the chances of it when they are expressed alone or together, then clearly those genes would need to have other effects alone or toget

        • Comment removed based on user account deletion
        • With two genes, you get sickle cell anemia and are quite likely to die young. With just one, you're much more likely to survive malaria.

          For homosexuality:

          With two genes, you like dudes and are quite unlikely to get one pregnant. With just one... maybe you can better resist the urge to screw women with obvious signs of an STD. Maybe you don't get yourself killed in a fight over a woman.

          Maybe you exist to be an unthreatening way to get women to spend time with your family... so that your brothers (sharing muc
      • "He believes "that if the gene [for homosexuality] were discovered and a woman decided not to give birth to a child that may have a tendency to become homosexual, she should be able to abort the fetus." Not to put too fine a point on it, but that strikes me as being rather too close to Third Reich thinking for my liking."

        Aborting a homosexual fetus is a little like aborting an Asperger fetus, someone who is just different and who certain segments of society shun, but in the case with Aspergers, the shunning
      • He and his colleagues knowingly stole vital DNA X-ray diffraction data from Rosalind Franklin and Raymond Gosling without their knowledge and consent (indeed, Franklin had even refused to share it), which tarnishes their acheivements.
        Did they steal it or copy it? How was it "vital"? If it's scientific data then shouldn't it just all be public anyway? (I'm not flaming. I really want to know the answers.)
        • It was stealing because they broke into her office and took it, or used a similar method equally dishonest. And that's completely apart from the issue of taking someone's unfinished work and then submitting it for publication as your own. What they did was close enough to plaigarism that I think the difference is insignificant. I've read about how it happened and basically Watson and Crick realized that whoever solved the problem of DNA structure would be famous. So they started bumming data off other sc
          • by Rich0 ( 548339 )
            I think part of the problem is the obsession among scientists of being the first to do something. Just think of all the grad students who spend 3 years on a project, only to get scooped by somebody else, and having to switch gears. Is their work somehow less original because it was done independently by somebody else ahead of them?

            The same sorts of issues exist with negative results. Nobody cares about them, but they're just as important as positive results. Especially when everybody keeps reinventing t
    • Re: (Score:3, Informative)

      by Bender0x7D1 ( 536254 )

      We also can't forget Rosalind Franklin - the "Dark Lady" of DNA [npr.org], who first pohotographed the DNA molecule.

  • Two DVD disks? (Score:3, Insightful)

    by MichaelSmith ( 789609 ) on Friday June 01, 2007 @11:22PM (#19360597) Homepage Journal
    So what's that, 16 gigabytes of information to describe one person. But this is a DNA profile, not necessarily something which can be turned back into DNA.
    • Re:Two DVD disks? (Score:5, Interesting)

      by neapolitan ( 1100101 ) on Friday June 01, 2007 @11:41PM (#19360659)
      I've often thought about this (I'm a doctor...)

      By my calculations:

      3 billion base pairs in the entire human DNA sequence (give or take). Each base pair can be A, C, T, or G. (look at wikipedia or biology text for details.) Thus, each base pair can be represented by a 2 bit number (00 01 11 or 10).

      Thus, 3 x 10^9 base pairs * 2 bits / base pair = 6 x 10^9 bits = 6 billion bits * 1 byte / 8 bits = .75 billion bytes = .75 GB = 750 MB.

      A standard DVD holds 4.3 GB, so you could fit almost 6 full humans on a DVD. Of course, this doesn't count compression (which would be astoundingly effective given repetition and patterns in DNA sequences) nor the fact you could just encode the delta as much DNA is conserved. In fact, very little DNA varies between humans, so I'd bet you could quite deterministically encode a human in as little as 100 MB if you had a "standard human DNA sequence" for reference.

      Of course, you would need some magical method to reconstruct this DNA and put it into an egg at the right timing, which would likely form an approximation of the identical twin of a person. The technology for this is not here yet. Also, this does not encode any of the proteins / apparatus / mother that is needed to go from DNA in egg to functioning human.

      Still, it is interesting to think about!
      • Comment removed based on user account deletion
      • The Human genome is about 3.5 billion bases, and you need 2 bits to encode 2 bases, which corresponds to 7Gigiabits of data. 1 byte is 8 bits. So you would need at least 875Megabytes to store your DNA. This, I'm sure, would be bloated somewhat with the extra encoding and CRC checking to ensure that a disk with your DNA isn't missing any bases.. Does anyone know how much more space would be required to ensure that the DNA is copied accurately? I've heard that disks use Reed-Solomon codes as a way of minimi
        • CDs and DVDs already contain error correction. If that error correction isn't enough, the first thing you'd need to do is figure out how much damage you expect to be able to recover from. If you're planning on keeping it in an armored container stored in a bank vault, you're probably fine - if you're planning on using it as a floor sander, you might have some trouble.

          "How much" depends entirely on your needs.
      • Re: (Score:3, Interesting)

        everyone talks about the actual coding sequence but not much about epigenetics- whether or not certain cytosine residues are methylated and what not- quite important if you think about it- put the whole sequence back together and certain genes dont quite work the same way. so really counting all of that it would take quite a significant amount of more information to truely be able to reconstruct the genome as it was. then again only about 3% is methylated in that fashion...
      • Only six? (Score:4, Funny)

        by quokkapox ( 847798 ) <quokkapox@gmail.com> on Saturday June 02, 2007 @01:29AM (#19361131)

        so you could fit almost 6 full humans on a DVD.

        Only six? With lossy compression, you could do significantly better, as long as you don't mind all your offspring being funny-but-similar-looking lactose-intolerant non-deterministic sociopathic freaks.

      • by Wolfrider ( 856 )
        --Dude... I think you might have just facilitated the invention of the Transporter, by an order of magnitude... ;-)
      • The problem is (currently studying bioinformatics after my medicine)
        apparently bioinformaticians have never heard of "compression" or "efficient use of space".

        The data (and it's associated metadata) is stored into formated ASCII thus the 12-fold increase of space requirement.

        [ Also for all wanna-be-DrEvils on /. : DNA synthesising error rate is low but not negligible, so you can't just "print those 2 DVD and grow your very own DrWatson". Plus cloning is a little bit more complicated than putting some DNA in
      • by RDW ( 41497 )
        But remember that (for the first time, and unlike the current reference assembly) these are diploid genomes, so you have to double those numbers. They're presumably stored as uncompressed ascii for convenience (so around 6Gb of data - maybe they should have used a dual-layer DVD!). However, 2-bit encoding is in fact used where space is at a premium (e.g. to fit a database derived from an entire genome into available RAM for BLAT or BLAST analysis). Here's the scheme used by BLAT:

        http://genome.ucsc.edu/FAQ/F [ucsc.edu]
      • The dataset probably includes certainty coefficients, SNR's or at minimum peak heights from the readers.
      • by tOaOMiB ( 847361 )
        Just to nitpick a little: you're off by a factor of 2, since we each have 2 copies of the 3 billion base pairs--one from Mommy, and one from Daddy.
    • Two DVD disks in each one of our trillions of cells. Pretty amazing data storage density, really. How much of it actually encodes for useful proteins/enzymes/etc may only be a tiny fraction but at some level it's all functional. Perhaps DNA computing will reduce the size/cost/power consumption of data centers someday. Wikipedia DNA Computing [wikipedia.org]
    • It would be interesting (albeit an ethical grey area) if one day we reached a stage where we can create a clone of someone from their genome (i.e. without needing their actual DNA). We'd be able to recreate people hundreds of years after they die.

      But we're still rather a while away from being able to stick together billions of base pairs and create a usable piece of DNA. However - it's actually been done before [sciencenews.org] (article is pretty old, I know) with simpler organisms (viruses) and their RNA, so it's not un
  • by manchineel ( 699602 ) on Friday June 01, 2007 @11:23PM (#19360615) Homepage
    However, Dr. Watson was told that he could not use his DNA, as it had been patented by the company and any use of his own DNA without proper permission would lead to serious legal consequences...
    • Though your comment is in jest, patents and intellectual property rights for DNA are in many ways trickier than even software patents.
  • All this to demostrate humans can be compressed to the size of 2 DVDs!
  • It may have been sequenced, but it will be some time before we have the technology to truly "decypher" or unlock the meaning of these sequences. Strikes me as a sensationalist headline.
    • Correct. Nothing has been decoded or 'decyphered'. It has been sequenced or transcribed.

      News stories with DNA are always encumbered with misleading inappropriate terms.
    • In addition to the sequencing being transcribed, it has been analyzed.
      • variations in 310 genes known to cause disease, were found.
      • with 23 which are specifically known to increase the risk of disease

      Future analyses will go much further.

      www.SNPedia.com [snpedia.com] is a resource to help unravel the effects of these variations. We will cross reference the Watson and Venter genomes as soon as they are actually released. To date, the genomes have not been released.

      If anyone can point to where these specific seque

  • by seven7h ( 926826 )
    Blu-Ray - Enough space to store your whole familys DNA!!

    Just hope the DRM isn't cracked or people could clone my whole family, DAMN...Too Late
  • Celera = bad news (Score:5, Interesting)

    by ushering05401 ( 1086795 ) on Friday June 01, 2007 @11:57PM (#19360735) Journal
    Just for anyone not following along:

    Celera is a bad news company, and news involving them should always set off alarm bells.

    They are decent at motivating people, though. Based on their track record and stated intentions they caused a massive movement to decode the human genome as public property after they announced they would compete with the federally funded decoding initiatives for the purpose of patenting the findings and licensing that data to private companies. As John Sulston, who led the British arm of the Human Genome Project put it: 'We were in a position of responsibility... without us, the human genome would be privatized.'

    Here's a quote from The New Atlantis:

    "Celera's mission was to sequence the human genome better and faster than its government-funded rival. It aimed to sell access to genomic information as well as the tools to interpret it, with an eye to "big pharma" and other biotechnology companies looking for a treasure trove of new drug targets."

    Venter, named in the submission, was the CEO of Celera at the time this strategy was developed and was deposed several months after it became clear that the public would beat Celera to the goal.

    This is admitedly troll bait, but I feel a burning personal need to inform people about this man's actions whenever I see his name in print.

    Regards.
    • Re: (Score:3, Insightful)

      by Rich0 ( 548339 )
      Ah, I remember those days.

      Basically, the issue was that the human genome project was operating under a rather long timeline (mostly based on the state of technology when the project started). Venter thought that using a massively-parallel approach to the problem and using computers to assemble the resulting mess of data would get the results faster, but with some gaps in the final data that would require follow-up. He started Celera to implement this idea.

      The business model was simple. All the data would
  • by martin-boundary ( 547041 ) on Saturday June 02, 2007 @12:09AM (#19360791)
    Oh oh, I hope they double checked the electrical generators at Genbank. If there's a blackout and the frogs get out of the neighbouring lab and mate with Watson's and Rothberg's DNA, we'll soon have a huge Watsosaurus chasing chicken sized Rothoraptors all over North America. Personally, I'm gonna sell my home, buy a Winnabago and settle down right next to the Grand Canyon, the monsters will never find me there!
  • May the actions of these men lead to greater freedom on information in the future!

    Accolades to those brave and capable enough to publish.

    The unlocking and sharing of humanity's knowledge is the only way to a successful future (this website is proof enough)!

  • I wonder how long it'll be before they get dna sequences of important people and make FoxDie (as in Metal Gear Solid) equivalents


    and no I didn't RTFA
  • While the term "decyphered" is incorrect (Jim Watson' and Craig Venter' genomes have "only" been REVEALED) - true "decyphering" will be much easier when a statistically significant Personal Genomes will be available. Thus far, it was ZERO (the one published was a "mix"). The two Personal Genomes will be practically identical as far as the "genes" are concerned. However, there will be much diversity in the "non-coding" (formerly "junk") DNA (see ample background at http://www.junkdna.com/ [junkdna.com] "Genomics beyond
  • 2 DVD's? (Score:5, Informative)

    by MikShapi ( 681808 ) on Saturday June 02, 2007 @02:51AM (#19361439) Journal
    I'm doing undergrad biochem and we've done this math several times, as has been mentioned here in other threads, 1GB is the ballpark amount of space a single UNCOMPRESSED human genome should take up.

    On one hand, this is a marginal underestimate because there are more than 4 DNA nucleobases (quite rare, but they exist and need to be recorded if you're profiling a genome).
    However, the genome should be quite happily compressable (think bz2 or some specialized lossless form of compression) due to MANY repeating sequences and the fact that most exons (that you'd normally use 6 bits to describe) can be described using 5 bits by pinpointing their product on an amino-acid table (numbering 20 members most of the time), or even 4 bits if you narrow that table from the 20-most-common to the 15-most-common and use the 16th position to describe less-common sequences using more bits, just to name a few reasons.
    Maybe a bit of added data they put in describes things we've learned about the data which wasn't physically present in the original DNA such as "here ends intron, here starts exon, here be boundary" etc.

    In short, it should be highly compressible and fit in way under 2 DVD's, so for the life of me I can't figure out what they plugged onto two DVDs. Software to decipher it? Gene database correlating what's in your personal genome to what the genes are known to do? Free BonziBuddy extra content? Bonus "behind the scenes" material?

    • Re: (Score:2, Funny)

      by Anonymous Coward

      Bonus "behind the scenes" material?

      I'm pretty certain most people don't want to see their very own "making of" documentaries...

    • Re: (Score:2, Informative)

      But you can't just point to the animo acid because the codons pointing to the same amino acid don't make the acid fold the same way when introduced to a protein.
      • Good point. Multiple combinations of bases may yield the same amino acid [ciliate.org], yet you want to be recording not only what acid gets created but also which of the possible gene sequences that creates it was used, in (the quite possible) case something else hinges off the same data. Data compression (reuse of the same stored information for more than one purpose) is IIRC not unheard of.

        And to think I've just proposed using lossy compression for DNA :-)
    • If you're cool, you'd diff someone's genome against the reference, then compress that result.

      This isn't the first genome sequenced, and I have to wonder if the coverage is anywhere near as deep as the reference. My guess is that the coverage is 2-3x at best, and they used the reference as a scaffold for assembly anyway.

      This is why the shortcut exists to measure 500K to 1M SNPs per person, since it captures 95+% of the genetic diversity of an individual.
    • Backup copy!
    • by RDW ( 41497 )
      Most tools for doing anything useful with a genome sequence expect an ascii-encoded text file. The reference assembly is usually distributed as a conventionally zipped or gzipped ascii file, which is about 900Mb compressed, and >3Gb uncompressed. Unlike the existing reference assembly, the Watson genome is diploid (has both his maternally and paternally inherited DNA), which equates to >6Gb of ascii-encoded data. This is more than will fit on a single-layer DVD, even without the Director's commentary!
    • by tOaOMiB ( 847361 )
      Erm, this is the whole sequence, and there is important variation that is non-coding. So: ~3Gigabases of human DNA, and there's 2 copies (both of which are recorded here, so that's 6 gigabases of DNA. While a certainly sensical way to store it (uncompressed even) would be to use 2 bits per base, results in 12 gigabits = 1.5 Gb which easily fits on a DVD, the stupid (but convenient) way involves just storing each base as a full byte (as a char: A C T or G), coming out to 6Gb. Enough for two DVDs. This le
    • The two DVDs include not only the DNA sequence, but the raw traces coming out of the sequencing machine. Those are quite bulky, but they allow you to check if the base calls are correct or to find evidence of heterozygosity.
  • I was at the presentation ceremony myself, and judging from what I heard, Dr Watson (and most in the medical and scientific community) believe that the most important thing which will come from these advances is the ability to make better informed decisions. In sequencing patients genomes: -An employer could blacklist you for being prone to mental illness. -A doctor can be swayed from one drug to another based previously noted reactions in persons with a particular genotype. -You may find out you have an i
  • by CopaceticOpus ( 965603 ) on Saturday June 02, 2007 @04:13AM (#19361681)
    Now we clone Dr. Watson, place his infant clone in a fake city set at the time of his birth, and see if he will grow up to make the same discoveries.

    Or did that already happen? Are we part of the simulation, doomed to ever repeat our part in the story of Watson's life? It's like that Groundhog's Day movie on /.! All posts are reposts!

    Sorry, I'm very tired... :)
  • Some people seem to disapprove of Watson and consider him unworthy of the glory arising from his discovery because of his supposed theft of Rosalind Franklin's data and what he has said about the the human race. Firstly, he didn't steal the data. It was shown to him by her colleague Maurice Wilkins albeit without her knowledge. Other essential data from the Wilkins/Franklin lab were provided to Francis Crick by Max Perutz, Crick's supervisor. He didn't break into her lab to steal it, or sneak a peek at her
  • I wonder how big the diff output would be?

There can be no twisted thought without a twisted molecule. -- R. W. Gerard

Working...