Forgot your password?
typodupeerror
Biotech Science

Human Gene Count Slashed 504

jd writes "The estimate for the number of genes in human genetic code has been savagely revised downwards. The new estimate, of between 20,000 to 25,000 genes is marginally less than the 27,000 for the Arabidopsis, a flowering plant in the mustard family. Earlier estimates had placed the number of genes at around 44,000 - or even as high as 100,000. Eric Lander of the Broad Institute in Cambridge, Massachusetts is quoted in the CNN story as saying that the number of genes isn't as crucial as how they are used." Read on for more, below.

jd continues: "This has the potential for making life extremely interesting for genetic engineers, given that both individual genes and interactions between genes must be proportionately more complex, in order to get the same level of complexity out. Half the number of genes equates to twice the information encoded in forms other than discrete physical blocks of code.

There is no mention in the article of a story running in 2002 of genetic therapies unexpectedly causing cancer, although if you now factor in the increased complexity of interactions, it is possible that such side-effects can be better understood and therefore prevented. The new estimates, therefore, are more than just idle curiosity but have the potential for impacting how the science is approached."

This discussion has been archived. No new comments can be posted.

Human Gene Count Slashed

Comments Filter:
  • Ah (Score:5, Funny)

    by Anonymous Coward on Wednesday October 20, 2004 @11:40PM (#10582668)
    Finally scientific proof that it's not the size that matters, it's how you use it.
    • ...it's not the size that matters, it's how you use it.

      But I still feel so insecure about my humanhood...

      Only 20,000 genes?? Aw, man.

    • Re:Ah (Score:5, Interesting)

      by anonymous cowherd (m ( 783253 ) on Thursday October 21, 2004 @12:06AM (#10582867) Homepage
      Note that even with "only" 20K genes, this still gives us nearly 400M subsets of 2 individual genes to ponder. The complexity of the human organism is not surprising. In fact, it would be surprising if it were not so complex.
      • Re:Ah (Score:4, Interesting)

        by kilonad ( 157396 ) * on Thursday October 21, 2004 @12:39AM (#10583078)
        And if we were to consider the possiblity of up to every gene interacting with each other, that would give us 20000!, or roughly 1.819e+77337 possibilities. (surprisingly enough, that didn't crash the windows calculator program, although it did take a second or two even on an A64)
      • My calculations indicate about 200 Million, not 400, but still significant.

    • by antic ( 29198 )
      Also revised is the number of paragraphs in the front page blurb for this article! That, however, has been revised upwards!


    • Eric Lander of the Broad Institute in Cambridge, Massachusetts is quoted in the CNN story

      Well, I guess he would know...

  • Genomes? (Score:3, Informative)

    by voidware ( 81513 ) on Wednesday October 20, 2004 @11:42PM (#10582680)
    That would be incorrect. The number of genomes in the human genome is 1.
    Brandon
  • genes, not genomes (Score:5, Informative)

    by Anonymous Coward on Wednesday October 20, 2004 @11:42PM (#10582685)
    It is the number of genes that has been revised down. The genome is the complete set of DNA and contains all the genes.
    • by Anonymous Coward on Wednesday October 20, 2004 @11:50PM (#10582750)
      This is particularly interesting because with less genes then there are less genes that can interact with each other (I'm not talking about major/minor genes). As scientists are learning, the inhibition and activation of genes is alot more complicated than expected. With less genes, it means that the methods such as histone inhibition or non-genetic micro-RNA are more significant. Of course, it may also mean that DNA isn't the holy grail of biology, like we all thought (instead it is a complex interaction between micro-RNA and DNA).
      • by delco ( 559517 ) on Thursday October 21, 2004 @01:11AM (#10583242)
        DNA isn't the holy grail of biology, like we all thought (instead it is a complex interaction between micro-RNA and DNA).

        Interesting. I'd go out on a limb and say it was the process of translation or even protein folding that is the actual holy grail.

        There are some camps that believe that the DNA->mRNA interaction (aka transcription) is less complex and more predictable than the mRNA->Protein interaction (aka translation). If my memory serves me well, the process of transcription usually produces a fairly good "copy" of the DNA sequence, while translation seems to have a few unknowns in how he sequence is transformed into AA chains. And then the way in which the proteins fold, and hence gain their function is still up for grabs.

  • by Saven Marek ( 739395 ) on Wednesday October 20, 2004 @11:44PM (#10582695)
    Does this level of complexity shrink a little as well as grow a little due to less genomes being in existence? I think while the interactions are common maybe when that common "language" is found then it will make things easier.

    The iPod Lite Project [theipodliteproject.com] taking orders soon.
    • by PhrostyMcByte ( 589271 ) <phrosty@gmail.com> on Wednesday October 20, 2004 @11:49PM (#10582739) Homepage
      I think a good analogy for the /. croud would be ASM and C. ASM has a very small set of instructions and can be very complex to piece together. C has a much larger set and it is relatively easy to use.
      • by metlin ( 258108 ) * on Thursday October 21, 2004 @12:30AM (#10583021) Journal
        I'm not sure how that is.

        "We just have to get used to the fact that we don't have many more genes than a worm," Rubin said.

        So how can humans be so complex with relatively few genes?


        Seems to me like the instruction sets are the same, while the coding complexity varies?
      • by avsed ( 168886 ) on Thursday October 21, 2004 @03:22AM (#10583849) Homepage Journal
        Actually, that's a bad analogy, since modern assembly possesses a significantly richer grammar than C. However, it is correct to say that the interactions between language elements (instructions) in ASM are very much simpler than in C.
        More on topic: Why are people surprised that millions of years of evolution has resulted in a high entropy encoding "format" (the genome) whose consituent elements are multipurpose and have complex interactions with each other? An animal is more evolved (has a history of more complex environmental interactions) than a plant, so why shouldn't its genome be less redundant / contain more entropy? Comparisons of number of genes are (to return to the computing analogy) like comparing two processors based on their physical size.
        D.
        • by MythoBeast ( 54294 ) on Thursday October 21, 2004 @12:10PM (#10588044) Homepage Journal
          This is definitely a mis-perception, usually based on the fact that most evolutionary descriptions only describe those things that lead up to humans. Plants are, in many cases, more highly evolved than animals are. Even than humans are. They just haven't specialized for intelligence.

          It is a mistake to think that supremacy in one area (intelligence) means supremacy in all areas. Some people pride themselves on being efficient workers, others pride themselves on being paid well to do very little. In the biological world, plants would be the "blue pill" type of creature, the type B personalities, and they're REALLY REALLY good at it.

          When I was working at Monsanto, I was told that wheat has a genetic strand about three times as long as the human genetic strand. This may or may not have relevance to the rest of the post, but I thought I'd toss it in just because it's interesting.

          As another point, the length of the strand doesn't necessarily indicate a more evolved state. It can be assumed that some strands are more efficient than others, and thus don't NEED to be as long. Take Microsoft code, for instance. Just because they take more code to do the job doesn't mean it's a superior product.
    • by oddwick11 ( 446434 ) <slashdot@vim-vigor.net> on Thursday October 21, 2004 @12:02AM (#10582830)
      Gauging the complexity is difficult, given there are a number of factors not currently understood, particularly the importance of non-coding RNA, which accounts for 98% of the genome. In the past, the information content of these regions was thought to be low, but this attitude is changing. As knowledge of the genome increases, the estimated number of genes drops, and more information emphasis is put on non-coding portions of the genome.

      Evaluating the function of ncRNA is difficult because as of yet there are no statistically significant markers for them. Given the release today, and trends of late, more and more attention will be put on trying to decipher the utility of "junk" DNA.
    • Does this mean that the fatter I get, the less complex I am? Wow...that should make my wife happy. ;)
    • by afidel ( 530433 ) on Thursday October 21, 2004 @12:21AM (#10582966)
      Actually last months Scientific American had a good article on this. Basically we are finding that what we once thought was junk (non coding areas and RNA coding areas which do not code for proteins) is probably some of the more important aspects of the nucleus. I quote:

      "But investigators have since sequenced the genomes of diverse species, and it has become abundantly clear that to correlation between numbers of conventional genes and complexity truly is poor. The simple nematode worm Caenorhabditis elegans (made up of only about 1,000 cells) has about 19,000 protein-coding genes, almost 50 percent more than insects (13,500) and nearly as many as humans (around 25,000). Conversely, the relation between the amount of nonprotein-coding DNA sequences and organism complexity is more sonsistent.
      • Genes -- Proteins (Score:5, Interesting)

        by oddwick11 ( 446434 ) <slashdot@vim-vigor.net> on Thursday October 21, 2004 @12:50AM (#10583134)
        An often unknown fact is that a single gene can code for thousands of different proteins. Protein regulation can occur in a variety of way, one of which is through "junk" DNA.

        Currently little is known on the exact mechanism, which is a huge impediment to proteomics. As the phenomenon is elucidated, expect to see a lot more useful information coming out of genome projects.

        Computationally predicting the 3-D structure and function of a gene is far more important than you probably realize. Reaching this point will revolutionize almost every aspect of your life, from pharmaceuticals, to nutrition, to silico-neural interfaces.
    • by Nutty_Irishman ( 729030 ) on Thursday October 21, 2004 @12:42AM (#10583093)
      On the contrary, the complexity now increases. There are many genes that act in completely differen't roles depending on the cell type (nerve, epidermal, etc.). So a common language changes from cell type to cell type-- if one would even call it a common language. There is a large part of Bioinformatics/Computational Biology that deals with trying to determine interaction networks between genes. It's very complex, and difficult to deal with.

      With less genes we then expect to have a larger amount of downstream interactions between other genes. It might seem that with less genes then we have less to worry about, but we have already speculated for a long time that gene regulatory networks are complex.

      To use an analogy (for all you computer geeks), it's like a programmer trying to read poorly modularized code. When you have no idea what class is doing what, and how they interact with other classes (as every class has multiple roles and talks to multiple other classes) then it is difficult to understand why the program behaves the way it does. If the program had many classes that were well modularized and designed with very distinct roles, then it would be easier to understand why things work the way they do.

      With less genes and increased complexity we have an even more difficult task. It also highlights some of the reasons on why microarray analysis has not done what we expected it to do. Increasing the complexity and dependency between genes means that we probably are going to take a longer time understanding and extrapolating information from all these networks (which means more job security for me :) ).
      • To use an analogy (for all you computer geeks), it's like a programmer trying to read poorly modularized code.

        To up the level of complexity, imagine that the blocks of code are randomly ordered (although blocks of genes tend to stay on the same chromosomes), are all executing in parallel, and can trigger reordering & rewriting of themselves & each other.

        Yep, that's going to be one helluva debugger!


      • On the contrary, the complexity now increases.

        I could not resist :D

        No the complexity does not increase. Its like it ever waas. We only know now, that it is not that simple as we allways thought.

        Some monthes ago, we thought it was simple. We realized things did not really work that good (gen therapy etc.) and wondered why. Now we know: oops, its not simple! And now we can look how to tackle the complexity.

        angel'o'sphere
  • by guy_davis ( 126776 ) on Wednesday October 20, 2004 @11:44PM (#10582697) Homepage
    The article poster mistook 'Genome' for 'Gene'. Organisms only have one genome as it is a collection of genes.

    Go to the back of the class!
    • by Anonymous Coward on Thursday October 21, 2004 @12:21AM (#10582967)
      Only one? Ahem: Mitochondrial genome; Nuclear genome.

      As a mitochondrial researcher, I resent the most important organelle of the cell being overlooked or lumped in together with the nucleus here!

      So I would say two genomes :)
  • enough... (Score:5, Funny)

    by micronix1 ( 590179 ) on Wednesday October 20, 2004 @11:45PM (#10582704)
    25,000 genes will be enough for everyone. - 2004
  • by nomadic ( 141991 ) <.nomadicworld. .at. .gmail.com.> on Wednesday October 20, 2004 @11:46PM (#10582711) Homepage
    The new estimate, of between 20,000 to 25,000 genomes is marginally less than the 27,000 for the Arabidopsis, a flowering plant in the mustard family.

    Damn elitist mustard, looking down on us.
  • by ignoramus ( 544216 ) on Wednesday October 20, 2004 @11:47PM (#10582719) Homepage
    In late breaking news, the final count of genomes in a typical human being has been found to be exactly 1. See http://en.wikipedia.org/wiki/Genome [wikipedia.org] for details.
  • by skraps ( 650379 )
    Proteome [wikipedia.org] research is the new genome research.
  • by DLR ( 18892 ) <dlrosenthal.gmail@com> on Wednesday October 20, 2004 @11:48PM (#10582733) Journal
    Where'd they off-shore the genes to?
  • People vs. Flowers (Score:3, Insightful)

    by k98sven ( 324383 ) on Wednesday October 20, 2004 @11:50PM (#10582751) Journal
    The new estimate, of between 20,000 to 25,000 genomes is marginally less than the 27,000 for the Arabidopsis, a flowering plant in the mustard family. Earlier estimates had placed the number of genomes at around 44,000 - or even as high as 100,000.

    AFAIK, there's a lot more research going into the human genome than into the Arabidopsis one. So one would naturally presume that the number of human genes would be known better.

    But if the estimate for the number of human genes is subject to so much variation, how can you be so sure of that for the Arabidopsis?

    Is this a meaningful comparison?

    (Not to mention that the entire premise seems to be flawed..)
    • Arabidopsis is essentially the lab rat of the plant biology world so trust me, there is a lot of research into Arabidopsis as well.
    • How many Libraries of Arabidopsis are there in one cubic Iota of Reasonable Doubt?

      Just Curious. :)
    • by larley ( 736136 ) on Thursday October 21, 2004 @12:19AM (#10582955)

      The thing is, we've had the arabidopsis genome sequenced for a while now. And because the organism has a lower degree of complexity it is a lot easier to study in many ways. I don't know if I'd necessarily say that there is more study being done on humans than on Arabidopsis - In fact, I highly doubt it.

      We have a much clearer idea of most of the inner workings of that lowly little mustard plant than of our own. It's a matter of understanding the simple stuff and then working our way up. Like with the nematode C. elegans -- we know more information about that than you could possibly imagine. We know how many cells it has at every stage of its life and what they are doing. We have its genome sequenced. And from all of this information we have learned a lot about the inner workings of our cells as well. You find a lot of homologies between organisms.

      In fact, if you examine the RNA polymerases of humans, bacteria and archaea you would find that ours are much closer to archaea (the most ancient of ancient organisms still around) than to bacteria.

      So looking at these organisms that have been around since the beginning of life, we can learn about the development of our genomes and by examining their functions we can learn much about how ours work. Even if we do have our entire genome sequenced, that doesn't mean we know what it all does.

  • Not only that... (Score:5, Interesting)

    by FiReaNGeL ( 312636 ) <fireang3l@hotmII ... inus threevowels> on Wednesday October 20, 2004 @11:50PM (#10582753) Homepage
    According to scientists, we gained 1000 genes compared to rodents when we diverged from them 75 millions years ago. And we 'lost' 33 genes compared to them (they have a functional copy, we have a nonfunctional pseudogene; it's still there, only not working - stop codons, etc).

    The "we must have more gene than (insert stupid animal or plant here)" is funny. Our superiority complex at its best.

    Read about the whole thing (with more links) on my blog (see sig)
  • You know... (Score:3, Insightful)

    by nwbvt ( 768631 ) on Wednesday October 20, 2004 @11:51PM (#10582756)
    I find it hard to take a site which claims to be scientifically literate seriously when they post an article which not once, but four times (including in the title) confuse the term 'gene' with 'genome'. Even my grandmother could probably tell the two apart. Come on guys, ever heard of the Human "Genome" Project? They were not mapping just one gene.

    How long before someone blames this on Bill Gates or George Bush?

  • by naden ( 206984 )
    Oh wait .. just read the post.

    Damn newbies ... hehe.
  • by grannyknot ( 604904 ) on Wednesday October 20, 2004 @11:52PM (#10582765)
    This items made me recall a science film we watched when I was in grade 8. It was all about chromosomes.

    There was an actor playing a typical I-don't-care-about-no-science-so- long-as-my-tractor-runs-right yokel who, as the 'scientist' (read: guy in a lab coat) noted that the fruit fly has five chromosomes and humans have 23, remarked "well, that's because people are the most advanced creatures on the planet."

    The look on his face was priceless when he found out that potatoes have over forty.
  • Was the advertising by google.. :)
    Human Genome on eBay
    Find human genome items at low prices. With over 5 million items for sale every...
    www.ebay.com
    Heh. "Now valued at more $$$/Gene! Buy it now?"
    • by larley ( 736136 ) on Thursday October 21, 2004 @12:02AM (#10582837)
      Well, technically, you CAN buy genes. There are quite a few companies that sell pre-sequenced genes. In fact, the entire genomes of several organisms are available in varying amounts ligated into Bacterial Artificial Chromosomes (BACs) and plasmids. An interesting link is http://www.arabidopsis.org/ - There's a lot of information on Arabidopsis, where they keep a database of the entire Arabidopsis genome as well as many freely-available tools for its analysis.
  • by Tezkah ( 771144 ) on Wednesday October 20, 2004 @11:55PM (#10582792)
    I was at a lecture by Evelyn Fox Keller [uci.edu], and she said that there has been a paradigm shift and we're moving from breaking up biology into tiny parts, to seeing the whole picture. Whether theres 100,000 or 20,000 genomes seems rather trivial.
    • Why it matters (Score:2, Informative)

      by oddwick11 ( 446434 )
      The shift from 100,000 to 20,000 predicted genes is important because it signals a fundamental change in the way genomics are viewed. Scientists have to consider non-obvious explanations for genetic phenomenon. Why do we have a small number of genes, but a high level of complexity?

      The genome is ~2% gene, the rest is largely unknown. Traditionally, this has been referred to as junk DNA, good for spacing, but not much else. Growing consensus believes there is more to these regions, and efforts are underw
  • More complex? (Score:3, Interesting)

    by T-Ranger ( 10520 ) <jeffw.chebucto@ns@ca> on Wednesday October 20, 2004 @11:56PM (#10582795) Homepage
    Would not reducing the number of genes from 100,000 down to 25,000 reduce the number of possible interactions from (100,000!/2) to (25,000!/2)? Thats a factor of a number that has 357480 digits!
  • Huh? (Score:3, Funny)

    by cmcguffin ( 156798 ) on Wednesday October 20, 2004 @11:56PM (#10582796)
    savagely revised

    What, did they revise the number with a chainsaw?
  • Now that the namespace is half as big, the properties are twice as valuable! Time to double up the patent lawyer staff.
  • Somewhat on, and somewhat off--topic, I'm reading a novel by Greag Bear called Darwin's Children [amazon.com]. And it's pretty deep...if not totally engrossing.

    It has a lot to do with viruses (especially 'ancient' viruses) being part and parcel of the process of human evolution.
  • Since we have fewer genes than a flower but are more complex, does this mean that the arrangement of our own genes - and of other organisms - is more important than the quantity? Does this in any way change the way in which geneticists are to evaluate the genomes of other species in the future?

  • Any good software programmer knows that good design and elegance beats bloat every time.
  • Woah (Score:3, Insightful)

    by timothv ( 730957 ) on Thursday October 21, 2004 @12:12AM (#10582900)
    Woah! More than one paragraph? Will Slashdot get rid of italics too, and start having quality articles?
    • Yeah, this article is huge on the front page. I thought for a second I had enabled some kind of "View Full Articles Always" option.
  • They're only counting the different sequences of DNA which are transcribed to give proteins. That's like counting the lines of C code in a program that abuses the preprocessor extensively. You're ignoring all the ifdefs, the macros, the set of makefiles and shell scripts stuffed into comments, and so forth.

    Sure, you have a small set of proteins. But these proteins are expressed or not expressed based on binding sites for other molecules in the non-transcribed DNA around the portion for the proteins; this i
  • by enderwig ( 261458 ) on Thursday October 21, 2004 @12:15AM (#10582916)
    to how many genomes are in a single human genome. However, speaking about genes in a genome, as the article states, this "correction" only counts those genes that make some discernable protein product. The number misses the number of open reading frames (ORF) that may not encode a protein at all, but a regulatory or enzymatic RNA. Probably, the next big project in life/medical research, after the big proteomics initiatives, will be the study of non-protein encoding ORFs. This problem is very tough to crack since 1) these RNA's do not have a common sequence element like "normal" messenger RNAs, 2) may be as short as 15 base pair (LIN12(?) in C. elegans), and 3) there are MANY, MANY possible ORFs in the genome.

    Are these technically genes? They are regulated. They have a function. They are transcribed. The only thing different from the standard definition of a gene is that the RNA is not translated into protein.

    In addition to multiple protein products from one "gene" as the article states, regulation of the gene may also be much more complex compared to "lower" organism. For example, the gene expression profile of the malarial parasite Plasmodium falciparum suggests very limited regulation. Basically, it looks like a linear progression with very limit amount of response. So, temporal and spatial regulation makes even multiple product genes seem to like a larger cohort of genes. Take the daughterless gene in Drosophila. It is used very early in embryonic development to control sexual differentiation. However, later, the gene product is used in neuronal differentiation. So, for the fly, sex is literally on the brain.
  • What makes people think that the intricate balance of our DNA achieved from 10s of thousands of years of evolution can be maintained when you make drastic localised changes like gene therapy? Stop treating humans like software systems where you can go in and refactor class interfaces as and when you like!
  • by jeif1k ( 809151 ) on Thursday October 21, 2004 @12:17AM (#10582937)
    There is no mention in the article of a story running in 2002 of genetic therapies unexpectedly causing cancer,

    Nor should there be; general estimates of the number of genes have nothing to do with mechanisms by which gene therapy might cause cancer. Nor is it unexpected that gene therapy can cause cancer; that has always been a known risk.

    although if you now factor in the increased complexity of interactions, it is possible that such side-efects can be better understood and therefore prevented.

    Anything is possible, I suppose. But common ways in which gene therapy could cause cancer are already understood. Doubtlessly, there are many more possibilities, but to identify them requires a specific understanding of those "interactions", something that is being worked on anyway.
    • There is no mention in the article of a story running in 2002 of genetic therapies unexpectedly causing cancer,

      Nor should there be; general estimates of the number of genes have nothing to do with mechanisms by which gene therapy might cause cancer. Nor is it unexpected that gene therapy can cause cancer; that has always been a known risk.

      To be more specific, the cancer caused by that form of gene therapy seems that the retrovirus used to insert a block of engineered DNA into the genome inserts the p
  • Genome videos (Score:3, Informative)

    by $exyNerdie ( 683214 ) on Thursday October 21, 2004 @12:21AM (#10582968) Homepage Journal

    PBS has excellent videos from the program Cracking the Code of Life [pbs.org]of the teams (Human Genome Project and private company Celera) that worked on decoding the entire 3 billion sequences of the human genome. It is very worth watching to understand this article.

  • Gene Therapy (Score:5, Insightful)

    by Camel Pilot ( 78781 ) on Thursday October 21, 2004 @12:23AM (#10582982) Homepage Journal
    Why are we not directing our massive GNP towards scientific exploration such as studying genetic therapies to cure the rift raft of ailiments that curse mankind instead of fighting petty wars against a minor enemy "aka terrorist".

    Let look at that stats:

    Terrorist kill ~ 3000 people in 2001 and it becomes a focus of the US nation. While:

    Breast cancer kills > 40,000 / year

    Prostate cancer kills > 30,000 / year

    Diabetes kills > 70,000 / year

    The numbers world wide of course are much larger.

    Yeah OT I know but these kind of discoveries convince me our priorities are misplaced.

    • Re:Gene Therapy (Score:2, Insightful)

      Because medicine is not that profitable, in fact you can waste your life savings just trying to stay alive. My parents shell out an ungodly amount of money for medications for their conditions every month I wonder how they even manage to pay the bills, my mother has $300+ worth of medication just for herself, my dad has even more then that. Just look at the people who pay through the nose for drugs, they can't all afford the R&D costs under a capitalistic system. So that means people get left out but
  • Metal Gear Solid 2 owns you all:

    Emma : It's not. In fact, something similar is already underway. Do you know how many genes exist in an individual?

    Raiden : About 30 to 40 thousand?

    Emma : Right. That's what was announced at the turn of the century. But there's actually 100 thousand, according to the original theory advanced by the scientific community. Information regarding the remaining 60 thousand was suppressed by the Patriots.

    R

  • Regardless of the error about "genomes" vs. "genes" . . .

    There are all sorts of DNA that don't encode for proteins, but do have functions. In the production of antibodies, for example, a cell uses a shotgun combinatorial attack using DNA as a template, basically a random-number source, to make a binding site for whatever antigen. There are certain sequences that are not genes, exactly, but can predispose a person towards autoimmune disorders.

    Someone correct me if I'm making any egregious errors. The M

  • by Pan T. Hose ( 707794 ) on Thursday October 21, 2004 @12:28AM (#10583008) Homepage Journal
    I've read the headline as "Human Genome Slashdotted" and I shouted: "Dear God, we're doomed!" My God, what an embarrassment... I need sleep.
  • Of course not. On a biochemical level, all mammals are pretty much the same.

    In fact, plants will need MORE genes than animals because more genes mean more chemical reactions they can perform and plants need a lot (flowering, mating, chemical signaling, anti bacterial/fungal chemicals--pretty much everything they DO is chemical), whereas in animals lot of the tasks can be done behaviorally (washing hands).

    It is surprising to me that scientists though thumans would have more genes than animals. The reason
  • ... two..... 1 and 0

    the matrix has you.... on the 13th floor of eXistenZ
  • number of possible genetic combinations: 27000! ~ infinity.
  • by marko123 ( 131635 ) on Thursday October 21, 2004 @12:43AM (#10583097) Homepage
    If there are less genes than we thought, the little buggers must be executing their comments.
  • "Half the number of genes equates to twice the information encoded in forms other than discrete physical blocks of code."

    I love the implicit anthropomorphism here. It could also mean simply that there's half as much information in you than you thought. Would that make you feel bad about yourself, thinking that you're less complicated than certain flowers? It could mean that the information density of the resulting blocks is greater, but it could just as easily not mean that. It could also mean that th
  • by vandelais ( 164490 ) on Thursday October 21, 2004 @01:06AM (#10583224)
    gatacgtactgagtctacgtacgtactgagtcatcagtctacgtacgtac gtatgcagtcagtcagtcagtctactgacgtacgtatactacgtatacgg gtagcgatctacgcatccggactgggatctcgtgtacgtacgtacgttag tcgtacgtgtgtatgcgttacgtttagcccaacacactgatgctgatcta gtactcgtaacgtgtacgtacgtacgtacgtacgtacgtacgtatcgagt acgtgtacgtacgtcatgacgtacgttagcgtagtagtagttcgtagtag tcgtgtagtcgtactggtactactacagtactacgtacgtacgttacggt acgtac gatacgtactgagtctacgtacgtactgagtcatcagtctacgtacgtac gtatgcagtcagtcagtcagtctactgacgtacgtatactacgtatacgg gtagcgatctacgcatccggactgggatctcgtgtacgtacgtacgttag tcgtacgtgtgtatgcgttacgtttagcccaacacactgatgctgatcta gtactcgtaacgtgtacgtacgtacgtacgtacgtacgtacgtatcgagt acgtgtacgtacgtcatgacgtacgttagcgtagtagtagttcgtagtag tcgtgtagtcgtactggtactactacagtactacgtacgtacgttacggt acgtacgatacgtactgagtctacgtacgtactgagtcatcagtctacgt gtatgcagtcagtcagtcagtctactgacgtacgtatactacgtatacgg gtagcgatctacgcatccggactgggatctcgtgtacgtacgtacgttag tcgtacgtgtgtatgcgttacgtttagcccaacacactgatgctgatcta gtactcgtaacgtgtacgtacgtacgtacgtacgtacgtacgtatcgagt acgtgtacgtacgtcatgacgtacgttagcgtagtagtagttcgtagtag tcgtgtagtcgtactggtactactacagtactacgtacgtacgttacggt acgtacgatacgtactgagtctacgtacgtactgagtcatcagtctacgt acgtac gtatgcagtcagtcagtcagtctactgacgtacgtatactacgtatacgg gtagcgatctacgcatccggactgggatctcgtgtacgtacgtacgttag tcgtacgtgtgtatgcgttacgtttagcccaacacactgatgctgatcta gtactcgtaacgtgtacgtacgtacgtacgtacgtacgtacgtatcgagt acgtgtacgtacgtcatgacgtacgttagcgtagtagtagttcgtagtag tcgtgtagtcgtactggtactactacagtactacgtacgtacgttacggt acgtacgatacgtactgagtctacgtacgtactgagtcatcagtctacgt acgtac gtatgcagtcagtcagtcagtctactgacgtacgtatactacgtatacgg gtagcgatctacgcatccggactgggatctcgtgtacgtacgtacgttag tcgtacgtgtgtatgcgttacgtttagcccaacacactgatgctgatcta gtactcgtaacgtgtacgtacgtacgtacgtacgtacgtacgtatcgagt acgtgtacgtacgtcatgacgtacgttagcgtagtagtagttcgtagtag tcgtgtagtcgtactggtactactacagtactacgtacgtacgttacggt acgtacgatacgtactgagtctacgtacgtactgagtcatcagtctacgt acgtac gtatgcagtcagtcagtcagtctactgacgtacgtatactacgtatacgg gtagcgatctacgcatccggactgggatctcgtgtacgtacgtacgttag tcgtacgtgtgtatgcgttacgtttagcccaacacactgatgctgatcta gtactcgtaacgtgtacgtacgtacgtacgtacgtacgtacgtatcgagt acgtgtacgtacgtcatgacgtacgttagcgtagtagtagttcgtagtag tcgtgtagtcgtactggtactactacagtactacgtacgtacgttacggt acgtac
  • We're not even close (Score:3, Informative)

    by mcrbids ( 148650 ) on Thursday October 21, 2004 @01:14AM (#10583262) Journal
    I remember reading about a researcher who wanted to study genetic algorithms. I wish I had a link handy, but googling didn't turn it up.

    Anyway, this guy wants to create a genetic algorithm that results in a circuit that can detect the difference between two tones, one something like 200 HZ and the other 2 KHZ.

    He uses an FPGA chip to do the testing with. After a few weeks, he has an FPGA programmed such that it reliably discerns between the two input signals.

    So, how does it work? Downloading the program from the FPGA chip results in a nonsensical circuit - except that it works. Running the same program on another FPGA chip of the same model results in a total failure.

    Even changing the power supply makes the circuit not work! Months of study results in a complete, total unknown. Results inconclusive.

    The human genome is not built of simple, engineered pieces. Interactions will occur with the total sum of possible interactions, down to the molecular level.

    It will be many, many years before our own microbiological structure is understood. As we proceed, we'll see information technology and biology merge, as, when push comes to shove, both consist of the replication of complex patterns.
  • Frogs (Score:4, Interesting)

    by FuzzyDaddy ( 584528 ) on Thursday October 21, 2004 @09:08AM (#10585331) Journal
    Gene count is a funny thing. Frogs, for example, have a lot of genes to guide their development from egg to tadpole to account for variations in water temperature and chemistry. Mammals gestate in a much more controlled environment (controlled temperature and chemistry), and hence do not need this huge complex of genes.

The only way to learn a new programming language is by writing programs in it. - Brian Kernighan

Working...