Banana to be Sequenced 225
GodsMadClown writes "New Scientist
reports
that a global consortium plans to sequence the genetic code of a wild banana from east Asia. Because bananas are triploidal instead of diploidal, they are only able to reproduce asexually, which means that it adapts slower than organisms reproducing sexually. 'One rule of joining the consortium is that any invention developed through the project and protected [by patent] will be made available to smallholders through a royalty-free license,' says Emile Frison, director of the International Network for the Improvement of Banana and Plantain."
So how long until (Score:1)
Re:So how long until (Score:1, Funny)
Bananas being sequenced... why? (Score:5, Informative)
Re:Bananas being sequenced... why? (Score:1)
After reading the original, the only thought I pulled from it was that of a banana orgy.
Re:Bananas being sequenced... why? (Score:5, Informative)
Re:Bananas being sequenced... why? (Score:2)
A small nit - most bananas eaten in the world don't come from a single species, it's the bananas exported to the West that come from a single species. That's still important, since that's were the money is.
But I think this is interesting because some of the tastiest bananas I've eaten aren't exported. They aren't suitable for various reasons, including thin skins that don't deal well with being shipped around the world. If they could introduce some of those yummie genes into export bananas it would be great.
Re:Bananas being sequenced... why? (Score:3, Funny)
Cripes! I for one don't want to imagine a world without bananas. Let's just hope that there's enough time to push banana-based technology to a point where we no longer have to be afraid.
Re:Bananas being sequenced... why? (Score:2)
Peanuts Too! (Score:2)
Re:Bananas being sequenced... why? (Score:2, Informative)
A more important point is that although GM may well be a cure, it remains to be seen whether or not consumers would accept modified bananas.
Re:Bananas being sequenced... why? (Score:2, Informative)
Apples too (Score:3, Interesting)
In his book, The Botany of Desire [amazon.com], Michael Pollan devotes a chapter to the apple and discusses at some length a similar problem. Apple trees are grown from cuttings from older trees already known to produce tasty apples. (The seeds in any given apple are all completely genetically different from the apple they came from and will not produce a tree of similarly-tasty fruit.)
Almost all the apple varieties we consume here in the States (Delicious, Gala, Fuji, and several other I can't remember) can trace their genes back to one tree from the 1800s. Whole industries are based upon this rather homogenous crop, and disease could be devasting. The current answer is heavy spraying of pesticides. Diversification of profitable appple varieties would be better though.
Some of the pages from this apple chapter can be read online [amazon.com] at Amazon (but not the most interesting ones, of course).
Bananas Face Extinction (Score:2, Interesting)
I can't imagine a world without bananas.
Re:Bananas being sequenced... why? (Score:2)
Cheetahs: yellow, have black spots, are experiencing problems due to low genetic diversity, don't have seeds
Bananas: yellow, may have black spots when very ripe, may experience problems due to low genetic diversity, don't have seeds
The real research question is not about sequencing the banana or the cheetah. I think we need to start researching whether cheetahs can be peeled and eaten for a tasty snack.
Re:Bananas being sequenced... why? (Score:2)
Cheetahs: yellow, have black spots, are experiencing problems due to low genetic diversity, don't have seeds
Bananas: yellow, may have black spots when very ripe, may experience problems due to low genetic diversity, don't have seeds
The real research question is not about sequencing the banana or the cheetah. I think we need to start researching whether cheetahs can be peeled and eaten for a tasty snack.
Heck, I would be happy with cheetahs that don't go spotty and then turn a sticky black shade if I leave them on the shelf for a week. At least they still retain their super-cheesy flavor thanks to all of those cheese-flavored sprinkles despite being stale inside.
Re:Bananas being sequenced... why? (Score:3, Funny)
Re:Bananas being sequenced... why? (Score:2)
You mean CostaRicans aren't westerners??? Boy, my knowledge of geography must be *way* outdated.
Re:Bananas being sequenced... why? (Score:2)
This BBC article gives a much better answer to the problem faced by banna growers: Bananas could split for good [bbc.co.uk]
The gist of the article is, without genetic modifications, bannas might go extinct within the decade.
"...the International Network..." (Score:3, Funny)
And here I was worrying that the world was in trouble. Now I can sleep at night.
Re:"...the International Network..." (Score:2)
His parents must be proud... (Score:1)
I wonder how I can get on the board of directors...
Duh! (Score:4, Funny)
Of course they reproduce asexually, who has ever seen two bananas humping eachother?
Fruit! ...so to speak. (Score:3, Funny)
I'm rather relieved that my Google search for "bananas pajamas porn" returned no results.
Re:Fruit! ...so to speak. (Score:5, Funny)
You're not kidding; in fact the theme song goes "Bananas in pajamas are coming down the stairs."
Powerful fruit indeed.
Re:Fruit! ...so to speak. (Score:2)
I always thought the Teletubbies [bbc.co.uk] were the gay heartthrobs. Oh well. The Bananas [abc.net.au] hang out with teddy bears, for what it's worth.
...laura
Re:Duh! (Score:1)
Seems like [agrolink.moa.my] they're having a lot of fun. Including S&M...
Re:Duh!: Warning SOT comment (Score:2, Funny)
There's a fruit store on our street
It's run by a Greek.
And he keeps good things to eat
But you should hear him speak!
When you ask him anything, he never answers "no".
He just "yes"es you to death,
And as he takes your dough, he tells you...
"Yes! We have no bananas
We have no bananas today!!
We have string beans and onions, cabBAges and scallions
And all kinds of fruit and say
We have an old fashioned toMAHto
A Long Island poTAHto, but
Yes! We have no bananas
We have no bananas today!"
Business got so good for him that he wrote home today,
"Send me Pete and Nick and Jim; I need help right away."
When he got them in the store, there was fun, you bet.
Someone asked for "sparrow grass"
and then the whole quartet
All answered:
"Yes, we have no bananas
We have-a no bananas today.
Just try those coconuts
Those wall-nuts and doughnuts
There ain't many nuts like they.
We'll sell you two kinds of red herring,
Dark brown, and ball-bearing.
But yes, we have no bananas
We have no bananas today."
On a more serious note... (Score:2)
Re:On a more serious note... (Score:2)
Because they use seeds. The fruit provides nourishment to the seedlings, and helps the seeds spread (animal eats fruit, walks around, craps, bananas grow in new place). It has nothing to do with sex. Get your mind out of the gutter.
Geez, get your mind out of the gutter (Score:2)
(Yes the original version of the comment referred to cigars. so?)
I misunderstood.. (Score:1)
Opensourced banana (Score:2, Funny)
Is that GPL or BSD ?
Re:Opensourced banana (Score:4, Funny)
Re:Opensourced banana (Score:2)
There is no mention as to whether it is GPL or BSD.
Doom and gloom in the world of nanas (Score:5, Funny)
According to a trivia game I was playing the other day, the banana is a herb, not fruit. Go figure.
Re:Doom and gloom in the world of nanas (Score:5, Interesting)
Re:Doom and gloom in the world of nanas (Score:2)
So is a fertile variant use to produce these cross-bred variants, or what?
Triploid fruit make sense, since being sterile they produce no seeds, which is all fine and dandy for us. Lots of species can be made triploid (seedless watermelons anyone?), but not all can survive without human intervention, as far as I know.
Re:Doom and gloom in the world of nanas (Score:2)
Re:Doom and gloom in the world of nanas (Score:2, Informative)
Re:Doom and gloom in the world of nanas (Score:2)
For those of you who are wondering what a "ploid" is, here's an FAQ on the subject. [ploids.com]
Wow, the internet r0cks! It's chock-full of useful information. It only took me 12 seconds to find that with Google(TM)!
Yes, that was a joke.....
No, it really wasn't funny.
No, I haven't had coffee yet.
Yes, I *am* sorry I bothered, but I couldn't resist the whole 'ploids' thing. What I can't figure out is how Frito-Lay got ahold of a word from genetics as a boxtop currency. Maybe it just sounds funny... ploids, ploids, ploids.... Yeah, that has to be it.
No, I don't work for Frito-Lay.
Yes, I hate myself now.
Re:Doom and gloom in the world of nanas (Score:2)
Re:Doom and gloom in the world of nanas (Score:2)
its both (Score:2, Interesting)
The Banana is a strange thing cos its both, a banana (the yellow thing you peel and eat) is undoubtedly a fruit (containing the seeds of the plant), though since commercially grown banana plants are sterile, the seeds are reduced to little specks.
However, the banana plant, though it is called a 'banana-tree' in popular usage, is technically regarded as a herbaceous plant (or `herb'), not a tree, because the stem does not contain true woody tissue.
Re:Doom and gloom in the world of nanas (Score:5, Informative)
(Musa sapientum) Technically speaking, the banana is a herb due to the
fact it is part of the flower made by the female plant. Botanically speaking,
it's a berry, due to the fact it's a fruit that developes from a plant ovary and
has little seeds.
Re:Doom and gloom in the world of nanas (Score:2)
Sheesh, it already sounds like a genetics experiment gone bad. And now they're going to sequence it and mess with its genes? What next, bananas which are tubers?
true (Score:1)
Re:Doom and gloom in the world of nanas (Score:2, Interesting)
Of course, if they sequence the genome, they may in the future be able to create a much safer, if rather boring, version of Jurassic Park, where we can all "see this astonishing 20th-century fruit(/herb) restored to to life in it's natural environment!!"
The problem of asexually reproducing crops (Score:5, Informative)
They downside is that all cuttings are genetically identical, so if a new disease or pest comes along, ALL commercial bananas are threatened. With other crops, crossbreeding with other strains can improve the resistance to the pests.
Introducing resistance genes in commercial bananas can only be done by genetic engineering. Remember that there are still wild sexually reproducing bananas out there, so maybe we will be eating hybrids of other species in the future.
Re:The problem of asexually reproducing crops (Score:2)
Now you've gone and done it... As if furries weren't bad enough, soon there's gonna be banana porn out there...
Re:The problem of asexually reproducing crops (Score:1)
Re:The problem of asexually reproducing crops (Score:5, Funny)
You wouldn't have a link to their site, would you?
Re:The problem of asexually reproducing crops (Score:1)
Ohh I hope so! Cross bred cowpig for that breakfast treat, or turkeychicken for sunday lunch!
Licensing? (Score:1, Insightful)
I'm confused (Score:3, Insightful)
Is there any other plant in the world that reproduces sexually?
Re:I'm confused (Score:4, Informative)
Genes are combined from two different sets to produce a single gene set and a new seed (now that's sexual).
Re:I'm confused (Score:1)
are defect and hence can not reproduce sexualy.
Bannanas are reproduced by taking the small
plants comming up from the main plant i.e.
they are cloned. The only changes that occure
is therefore by mutations.
Re:I'm confused (Score:5, Informative)
These terms refer to the number of sets of chromosomes each cell of an organism carries. Diploid is like us with 2 sets triploid is predictably 3 sets. Having 3 sets of chroromsomes is no problem untill you have to half the chrosomme number in making gametes (sperms, egg, pollen etc) A triploid organism can't make viable gametes, so is sterile.
Not all Bananas are triploid though, we reproduce triploid ones because not bothering with reproduction they are more vigorous in there growth and wont make seeds. Seedless watermelons are triploid and there are even (engineered) triploid carp, used to clear weed from lakes etc but denied the chance to reproduce and start a population
Re:I'm confused (Score:2)
Asian banana or the western? (Score:1)
Now to put them in the edible varieties , shouldnt they also be sequenced?
Also can't they put in the genes which make the Western bananas taste good into the wild ones? The fact that they grow in the wild should make it easier to grow, right?
Is suppose the banana scientists have thought of all that
Well,atleast the genes being open to all redefines the term banana re-public.....
Re:Asian banana or the western? (Score:1)
INIBAP (Score:2)
Observe the birth of a new acronym!
banana in your pocket (Score:5, Funny)
funny, i was *just* reading about this (Score:2, Informative)
on the other hand - I have to wonder, while interesting how does this article fit in slashdot?
Re:funny, i was *just* reading about this (Score:1)
Goblin
This is bad for the MPAA (Score:3, Funny)
hupp! (Score:1)
Be it wrong as it may, but somehow it felt right.
pictures? (Score:1, Funny)
I think I have a picture of that somewhere.
no royalties? (Score:3, Funny)
Do they know to beware clever ideas put forward by the biochemists from the Rambus contingent?
banana? (Score:1)
Knock Knock (Score:5, Funny)
Now we can finally update that tired knock-knock joke:
Re:Knock Knock (Score:2)
Knock, Knock!
Who's there?
GCACCAATGCACCTGAAGCTCAGCTTAA...
GCACCAATGCACCTGAAGCTCAGCTTAA... who?
Knock, Knock!
Who's there?
GCACCAATGCACCTGAAGCTCAGCTTAA...
GCACCAATGCACCTGAAGCTCAGCTTAA... who?
Knock, Knock!
Who's there?
GCACCAATGCACCTGAAGCTCAGCTTAA...
GCACCAATGCACCTGAAGCTCAGCTTAA... who?
Knock, Knock!
Who's there?
Orange.
Orange who?
Orange you glad I didn't say
GCACCAATGCACCTGAAGCTCAGCTTAA... again?
Not to nitpick... well, ok, to nitpick, I think it would actually go something more like this(missing part in bold:
Knock, Knock!
Who's there?
GCACCAATGCACCTGAAGCTCAGCTTAA...
GCACCAATGCACCTGAAGCTCAGCTTAA... who?
GCACCAATGCACCTGAAGCTCAGCTTAA Knock, Knock!
Who's there?
GCACCAATGCACCTGAAGCTCAGCTTAA...
We need to be vigilant with our intellectual history
cheers.
What? Bananas have their own network? (Score:1)
Not to be confused with:
- National Association for the Advancement of Oranges
- Society for the Prevention of Cruelty to
Kumquats
- Foundation for a Better Blueberry
- Organization of Anthropomorphic
Carrots [lismemories.com]
and the little known:Shouldn't this be in the humor section? (Score:2)
In other news, the National Organization for the Reform of Marijuana Laws announced plans to sequence the Cannabis sativa genome. A group spokesman said, "We're hoping this project will lead to. . . um. . . shit, I think I ate my notes."
What about strawberries? (Score:1, Informative)
1. Clone
2. Insert DNA
3. ???
4. Profit!
Seriously, most strawberries are quadriploidal (4N), by design. They are larger this way, what about research in this direction? I'd be much angrier if there were no strawberries!
Abrosial Wild bananas (Score:3, Interesting)
Re:Abrosial Wild bananas (Score:2)
super-banana (Score:3, Funny)
Here is the proper sequence (Score:4, Funny)
mmmmm...
The things you learn about bananas (Score:5, Funny)
-Esme
Triploidy \neq Asexual reproduction (Score:5, Interesting)
In the next step, such gametes need to be fertilized, i.e., 2 cells, just like a sperm cell and egg cell, need to be fertilized and merged together. If this results in a cell with 3 chromosomes of each chromosome type, a new banana child can grow from this. But since gametes contain 1 or 2 of each type of chromosome, and they have 11 such types, there is only a 1/2^11 change that this sexual reproduction is succesful.
Note that this only applies to the cultivated banana, as we know it from the super market. And you've probably never eaten a banana with pits in it. Bananas with pits exist, but there's only one in about 2048. These bananas can be used to create new banana trees, and they're different from their not-succesful bananas in that they are a lot smaller, and not edible, if compared to common cultivated bananas.
What will we do if it went extinct? (Score:4, Funny)
Bananas even.
Problems with banana (Score:2)
Nice story, but wrong (Score:5, Informative)
Re:Nice story, but wrong (Score:5, Funny)
Re:Nice story, but wrong (Score:2)
Should this be marketed as a wholesome fruit, or an adult toy?
Are you happy to see me... (Score:2)
simpsons reference (Score:2)
Straight Bananas Boring? (Score:3, Funny)
I guess Frison finds gay bananas much more interesting than straight bananas.
guess we know what OS bananas use (Score:2)
this means they must be geeks, and well, we all know geeks use linux.
WHAT?!!?!?! (Score:2)
Wakka-wakka-wakka!
Obligatory Simps... (Score:2)
Sign 'O The Times (Score:2)
Yeah yeah, so it's a rather obvious point.
--Mid
Bananas? (Score:2)
more info (Score:2)
heh heh
Travis
Re:more info (Score:2)
The banna that fell off the truck (Score:2)
Heavy on the Pesticides, Fungicides, etc (Score:2)
I don't think I want to eat them any more. They can't be healthy for me.
What I Learned from this Article (Score:2)
2. Bananas are by far the most heavily sprayed crop in the world.
3. "Wild banana" would probably make a great name for a band.
Banana sequenced long ago (Score:2)
Surely anyone here over the age of thirty-five remembers the theme song:
One banana, two banana, three banana, four
Four bananas make a bunch and so do many more
Over hill and highway the banana buggies go
Comin' to bring you the Banana Split show
Bananas could be threatened (Score:2)
The fungus, Sigatoka, is devastating plants in Africa.
And experts say it threatens to spread to all edible varieties of the fruit, killing them within ten years.