Forgot your password?
typodupeerror
Science

Banana to be Sequenced 225

GodsMadClown writes "New Scientist reports that a global consortium plans to sequence the genetic code of a wild banana from east Asia. Because bananas are triploidal instead of diploidal, they are only able to reproduce asexually, which means that it adapts slower than organisms reproducing sexually. 'One rule of joining the consortium is that any invention developed through the project and protected [by patent] will be made available to smallholders through a royalty-free license,' says Emile Frison, director of the International Network for the Improvement of Banana and Plantain."
This discussion has been archived. No new comments can be posted.

Banana to be Sequenced

Comments Filter:
  • New McDonalds Banana(tm) made from real(tm) Bananas! Hits our stores?
    • by Anonymous Coward
      Hey, it can't be worse than the Mc Meat Patties (tm) made from **100% real patty**!!
  • by phreak404 ( 241139 ) on Thursday January 16, 2003 @06:24AM (#5093195)
    The original story description was entirely non-coherent. So for anyone who actually cares, according to the article, bananas are being sequenced because the varieties favored by Western civilization are a nautral hybrid, and also happen to be sterile. This makes it impossible to crossbreed with Asian varieties that are more resistant to pests and diseases, hence, gene sequencing... all so that CostaRicans can use less pesticides, make more money from all of us banana loving Westerners.
    • Thank you.
      After reading the original, the only thought I pulled from it was that of a banana orgy.
    • by tjensor ( 571163 ) on Thursday January 16, 2003 @06:47AM (#5093249) Journal
      There is very good reason for genetic research into Bananas. Almost all Banans eaten in the world are from a single species, which is almost sterile - note the lack of seeds in your lunchtime Banana. There are several diseases which, if they got into the main Banana growing parts of the world, could seriously threaten the very existence of the Banana. This would be devastating for many small, poor countries, as they not only rely on the Banana economically, but as a staple food as well. Check out this months New Scientist.
      • A small nit - most bananas eaten in the world don't come from a single species, it's the bananas exported to the West that come from a single species. That's still important, since that's were the money is.

        But I think this is interesting because some of the tastiest bananas I've eaten aren't exported. They aren't suitable for various reasons, including thin skins that don't deal well with being shipped around the world. If they could introduce some of those yummie genes into export bananas it would be great.

      • could seriously threaten the very existence of the Banana

        Cripes! I for one don't want to imagine a world without bananas. Let's just hope that there's enough time to push banana-based technology to a point where we no longer have to be afraid.
      • Reading the article, it appears that these diseases are already in the major growing areas. And also, contrary to a previous post, these diseases mutate to resist traditional remedies so fast that treatment (pesticides) is not an option. Therefore there is a real urgency to this research - if not completed, there seems to be a real chance that the banana as we know it will simply be extinct.

        A more important point is that although GM may well be a cure, it remains to be seen whether or not consumers would accept modified bananas.
        • Today's guardian has an article about these fungal diseases which threaten this staple of many poorer countries "Yes - in 10 years we may have no bananas" [guardian.co.uk] so this reseach comes not a moment to soon. Apparently some Honduran scientists peeled and sieved 400 tonnes of bananas to find just 15 seeds for breeding - and have come up with a fungus resistant variety which can be grown organically, so hopefully the GM route maybe a non-starter...
      • Apples too (Score:3, Interesting)

        by johnlenin1 ( 140093 )

        In his book, The Botany of Desire [amazon.com], Michael Pollan devotes a chapter to the apple and discusses at some length a similar problem. Apple trees are grown from cuttings from older trees already known to produce tasty apples. (The seeds in any given apple are all completely genetically different from the apple they came from and will not produce a tree of similarly-tasty fruit.)

        Almost all the apple varieties we consume here in the States (Delicious, Gala, Fuji, and several other I can't remember) can trace their genes back to one tree from the 1800s. Whole industries are based upon this rather homogenous crop, and disease could be devasting. The current answer is heavy spraying of pesticides. Diversification of profitable appple varieties would be better though.

        Some of the pages from this apple chapter can be read online [amazon.com] at Amazon (but not the most interesting ones, of course).

      • I just read an article [bbc.co.uk] on how the rate of banana crop failures from pests and disease are at a current rate that they may be gone in ten years if nothing can be done to stop it. Genitically engineering more resistant bananas is one option.

        I can't imagine a world without bananas.

    • s/Westerners/Monkeys/
    • all so that CostaRicans can use less pesticides, make more money from all of us banana loving Westerners

      You mean CostaRicans aren't westerners??? Boy, my knowledge of geography must be *way* outdated.
      ;-) (smiley here for humor impaired moderators)

    • This BBC article gives a much better answer to the problem faced by banna growers: Bananas could split for good [bbc.co.uk]

      The gist of the article is, without genetic modifications, bannas might go extinct within the decade.

  • by tooloftheoligarchy ( 557158 ) on Thursday January 16, 2003 @06:24AM (#5093196)
    "...for the Improvement of Banana and Plantain?!"

    And here I was worrying that the world was in trouble. Now I can sleep at night.
    • That's nothing. Near where I live (West Hollywood) we have both the International Yogurt Company and the California Wool Bureau. Both buildings are obvious CIA fronts, as nobody ever goes in or out and they've been there for over 20 years.
  • I'm sure when his parents see long time friends they proudly announce that their wonderful son/daughter is director of the International Network for the Improvement of the Banana and Plantain...

    I wonder how I can get on the board of directors...
  • Duh! (Score:4, Funny)

    by Dark Lord Seth ( 584963 ) on Thursday January 16, 2003 @06:27AM (#5093205) Journal
    they are only able to reproduce asexually

    Of course they reproduce asexually, who has ever seen two bananas humping eachother?

    • There's evidently an australian children's show called "Bananas in Pajamas," which has some rather nightmarish [angelfire.com] homoerotic(?) overtones.

      I'm rather relieved that my Google search for "bananas pajamas porn" returned no results.
    • Hm. Obviously you've never seen how they grow.
      Seems like [agrolink.moa.my] they're having a lot of fun. Including S&M...
    • Since this is the funny thread. My SOT (Slightly off topic) comment will be banana related... I sing this all the time at karaoke. Imagine that. It will in the very least put a smile on your face.

      There's a fruit store on our street
      It's run by a Greek.
      And he keeps good things to eat
      But you should hear him speak!

      When you ask him anything, he never answers "no".
      He just "yes"es you to death,
      And as he takes your dough, he tells you...

      "Yes! We have no bananas
      We have no bananas today!!
      We have string beans and onions, cabBAges and scallions
      And all kinds of fruit and say
      We have an old fashioned toMAHto
      A Long Island poTAHto, but

      Yes! We have no bananas
      We have no bananas today!"

      Business got so good for him that he wrote home today,
      "Send me Pete and Nick and Jim; I need help right away."
      When he got them in the store, there was fun, you bet.
      Someone asked for "sparrow grass"
      and then the whole quartet
      All answered:

      "Yes, we have no bananas
      We have-a no bananas today.
      Just try those coconuts
      Those wall-nuts and doughnuts
      There ain't many nuts like they.
      We'll sell you two kinds of red herring,
      Dark brown, and ball-bearing.
      But yes, we have no bananas
      We have no bananas today."
    • If bananas don't reproduce sexually, then why do they produce fruit?
      • IANABB (I am not a banana botanist) but...

        Because they use seeds. The fruit provides nourishment to the seedlings, and helps the seeds spread (animal eats fruit, walks around, craps, bananas grow in new place). It has nothing to do with sex. Get your mind out of the gutter.
    • Sometimes, a banana is just a banana.

      (Yes the original version of the comment referred to cigars. so?)
  • Thought it had something to do with a song or band called Banana being sequenced (i.e. recreated in MIDI) haha

  • 'One rule of joining the consortium is that any invention developed through the project and protected [by patent] will be made available to smallholders through a royalty-free license,' says Emile Frison, director of the International Network for the Improvement of Banana and Plantain"
    Is that GPL or BSD ?
  • by Scorchio ( 177053 ) on Thursday January 16, 2003 @06:35AM (#5093222)
    When my alarm clock went off this morning, BBC Radio 1 news was in full soothsayer mode, foretelling how bananas will be wiped out by disease in ten years if nothing is done. Horrified, I hit snooze.

    According to a trivia game I was playing the other day, the banana is a herb, not fruit. Go figure.
    • by Solitary Angel ( 641049 ) on Thursday January 16, 2003 @06:40AM (#5093235)
      Actually the banana plant is the worlds largest herb... the banana is still fruit ;) And they cross breed bananas all the time. You can buy Apple Bananas which are smaller, fatter and sweeter... Ahh the knowledge I have gained from having a dad who sells bananas :)
      • How exactly are bananas cross bred? Triploid individuals can ce created by breeding diploid and tetraploid variants, that much I know.

        So is a fertile variant use to produce these cross-bred variants, or what?

        Triploid fruit make sense, since being sterile they produce no seeds, which is all fine and dandy for us. Lots of species can be made triploid (seedless watermelons anyone?), but not all can survive without human intervention, as far as I know.
        • Can anybody explain what diploid, Triploid, and tetraploid actually means? (I know 2- 3- and 4, but anything else?)
          • N-ploid means N sets of chromosomes. Humans are diploid, having two sets. The general term is polyploid [weihenstephan.de] for three or more sets of chromosomes. See link for more info (in English).

            • For those of you who are wondering what a "ploid" is, here's an FAQ on the subject. [ploids.com]

              Wow, the internet r0cks! It's chock-full of useful information. It only took me 12 seconds to find that with Google(TM)!








              Yes, that was a joke.....
              No, it really wasn't funny.
              No, I haven't had coffee yet.
              Yes, I *am* sorry I bothered, but I couldn't resist the whole 'ploids' thing. What I can't figure out is how Frito-Lay got ahold of a word from genetics as a boxtop currency. Maybe it just sounds funny... ploids, ploids, ploids.... Yeah, that has to be it.
              No, I don't work for Frito-Lay.
              Yes, I hate myself now.

    • its both (Score:2, Interesting)

      by Anonymous Coward

      The Banana is a strange thing cos its both, a banana (the yellow thing you peel and eat) is undoubtedly a fruit (containing the seeds of the plant), though since commercially grown banana plants are sterile, the seeds are reduced to little specks.
      However, the banana plant, though it is called a 'banana-tree' in popular usage, is technically regarded as a herbaceous plant (or `herb'), not a tree, because the stem does not contain true woody tissue.
    • by Anonymous Coward on Thursday January 16, 2003 @06:45AM (#5093243)
      Banana -
      (Musa sapientum) Technically speaking, the banana is a herb due to the
      fact it is part of the flower made by the female plant. Botanically speaking,
      it's a berry, due to the fact it's a fruit that developes from a plant ovary and
      has little seeds.

      • Technically speaking, the banana is a herb due to the fact it is part of the flower made by the female plant. Botanically speaking, it's a berry, due to the fact it's a fruit that developes from a plant ovary and has little seeds.

        Sheesh, it already sounds like a genetics experiment gone bad. And now they're going to sequence it and mess with its genes? What next, bananas which are tubers?
    • Scorchio's not kidding; I heard it on the radio too.
    • He's not wrong, you know. The BBC reckons banans may become extinct [bbc.co.uk].

      Of course, if they sequence the genome, they may in the future be able to create a much safer, if rather boring, version of Jurassic Park, where we can all "see this astonishing 20th-century fruit(/herb) restored to to life in it's natural environment!!"

  • by axolotl_farmer ( 465996 ) on Thursday January 16, 2003 @06:36AM (#5093226)
    The kind of bananas the we buy in our stores are triploid hybrids. This means that they are sterile and produce no seeds. They are reproduced from cuttings of the creeping underground stem, the 'banana trees' are actually upshoot from this.

    They downside is that all cuttings are genetically identical, so if a new disease or pest comes along, ALL commercial bananas are threatened. With other crops, crossbreeding with other strains can improve the resistance to the pests.

    Introducing resistance genes in commercial bananas can only be done by genetic engineering. Remember that there are still wild sexually reproducing bananas out there, so maybe we will be eating hybrids of other species in the future.
  • Licensing? (Score:1, Insightful)

    by Anonymous Coward
    Royalty-free, sure. But what about the up-front fee? Oh, prohibitive? Thank you.
  • I'm confused (Score:3, Insightful)

    by hdparm ( 575302 ) on Thursday January 16, 2003 @06:38AM (#5093233) Homepage
    Because bananas are triploidal instead of diploidal, they are only able to reproduce asexually, which means that it adapts slower than organisms reproducing sexually.

    Is there any other plant in the world that reproduces sexually?

    • Re:I'm confused (Score:4, Informative)

      by Hairy Fop ( 48404 ) on Thursday January 16, 2003 @06:42AM (#5093239) Homepage
      Any plants with flowers are examples of sexual reproduction in plants. The pollen of one flower being transferred to the stamen of another by insects is an example of sexual reproduction.

      Genes are combined from two different sets to produce a single gene set and a new seed (now that's sexual).
      • Allmost... Bananas do have flowers, but they
        are defect and hence can not reproduce sexualy.

        Bannanas are reproduced by taking the small
        plants comming up from the main plant i.e.
        they are cloned. The only changes that occure
        is therefore by mutations.
    • Re:I'm confused (Score:5, Informative)

      by 20_ooodbye ( 535341 ) <winda002@student.otago.ac . n z> on Thursday January 16, 2003 @07:20AM (#5093317)
      There seems to be a bit of confusion caused by the terms diploid and triploid.
      These terms refer to the number of sets of chromosomes each cell of an organism carries. Diploid is like us with 2 sets triploid is predictably 3 sets. Having 3 sets of chroromsomes is no problem untill you have to half the chrosomme number in making gametes (sperms, egg, pollen etc) A triploid organism can't make viable gametes, so is sterile.

      Not all Bananas are triploid though, we reproduce triploid ones because not bothering with reproduction they are more vigorous in there growth and wont make seeds. Seedless watermelons are triploid and there are even (engineered) triploid carp, used to clear weed from lakes etc but denied the chance to reproduce and start a population
    • You mean besides marijuana, hops, and avocados (in which the plant is either male or female)? Or any other flowering plant (in which both "male" gametes and "female" zygotes are produced)?
  • They say they will sequence wild bananas first (rather than the kind we eat) so that the relevant choromosomes/genes/whatever else can be put in the edible varieties to make them resistant to disease etc.
    Now to put them in the edible varieties , shouldnt they also be sequenced?
    Also can't they put in the genes which make the Western bananas taste good into the wild ones? The fact that they grow in the wild should make it easier to grow, right?
    Is suppose the banana scientists have thought of all that ....
    Well,atleast the genes being open to all redefines the term banana re-public.....
  • "the International Network for the Improvement of Banana and Plantain.".

    Observe the birth of a new acronym! ;-)
  • Hey Emile Frison, is that a banana in your pocket or are you just the director of the International Network for the Improvement of Banana and Plantain?
  • here [sciam.com] on SciAm they have some cool stuff about this in general.

    on the other hand - I have to wonder, while interesting how does this article fit in slashdot?

  • by martin-boundary ( 547041 ) on Thursday January 16, 2003 @06:58AM (#5093275)
    Once they find and patent the banana's "funny" gene, slapstick comedy movie production prices will go through the roof...
  • "Banana To Get Sentenced" I read..
    Be it wrong as it may, but somehow it felt right.
  • pictures? (Score:1, Funny)

    by Anonymous Coward
    ... bananas.. sexually...

    I think I have a picture of that somewhere.
  • by magarity ( 164372 ) on Thursday January 16, 2003 @07:15AM (#5093305)
    'One rule of joining the consortium is that any invention developed through the project and protected [by patent] will be made available to smallholders through a royalty-free license,'

    Do they know to beware clever ideas put forward by the biochemists from the Rambus contingent?
  • So they think they own the genome for a particular banana.
  • Knock Knock (Score:5, Funny)

    by devnullkac ( 223246 ) on Thursday January 16, 2003 @07:24AM (#5093327) Homepage

    Now we can finally update that tired knock-knock joke:

    Knock, Knock!

    Who's there?
    GCACCAATGCACCTGAAGCTCAGCTTAA...
    GCACCAATG CACCTGAAGCTCAGCTTAA... who?
    Knock, Knock!
    Who's there?
    GCACCAATGCACCTGAAGCTCAGCTTAA...
    GCACCAATG CACCTGAAGCTCAGCTTAA... who?
    Knock, Knock!
    Who's there?
    GCACCAATGCACCTGAAGCTCAGCTTAA...
    GCACCAATG CACCTGAAGCTCAGCTTAA... who?
    Knock, Knock!
    Who's there?
    Orange.
    Orange who?
    Orange you glad I didn't say GCACCAATGCACCTGAAGCTCAGCTTAA... again?
    • Now we can finally update that tired knock-knock joke:

      Knock, Knock!
      Who's there?
      GCACCAATGCACCTGAAGCTCAGCTTAA...
      GCACCAATGCACCTGAAGCTCAGCTTAA... who?
      Knock, Knock!
      Who's there?
      GCACCAATGCACCTGAAGCTCAGCTTAA...
      GCACCAATGCACCTGAAGCTCAGCTTAA... who?
      Knock, Knock!
      Who's there?
      GCACCAATGCACCTGAAGCTCAGCTTAA...
      GCACCAATGCACCTGAAGCTCAGCTTAA... who?
      Knock, Knock!
      Who's there?
      Orange.
      Orange who?
      Orange you glad I didn't say
      GCACCAATGCACCTGAAGCTCAGCTTAA... again?

      Not to nitpick... well, ok, to nitpick, I think it would actually go something more like this(missing part in bold:

      Knock, Knock!
      Who's there?
      GCACCAATGCACCTGAAGCTCAGCTTAA...
      GCACCAATGCACCTGAAGCTCAGCTTAA... who?
      GCACCAATGCACCTGAAGCTCAGCTTAA Knock, Knock!
      Who's there?
      GCACCAATGCACCTGAAGCTCAGCTTAA...

      We need to be vigilant with our intellectual history :)

      cheers.
  • ...the International Network for the Improvement of Banana and Plantain

    Not to be confused with:
    • National Association for the Advancement of Oranges
    • Society for the Prevention of Cruelty to Kumquats
    • Foundation for a Better Blueberry
    • Organization of Anthropomorphic Carrots [lismemories.com]
    and the little known:
    • Consortium of Fruit Hacking Doodz
  • Seems like anyone looking to draw attention to their organism of choice simply announces a new genome project. You'd think they'd wait to see how useful the human sequence is first- after all, many millions more dollars are being spent researching and analyzing that, and it's still taking a while for people to produce anything useful from it. It's a valuable reference, but I doubt banana research is as intensive and sophisticated as research in human genetics. (Just a hunch.)

    In other news, the National Organization for the Reform of Marijuana Laws announced plans to sequence the Cannabis sativa genome. A group spokesman said, "We're hoping this project will lead to. . . um. . . shit, I think I ate my notes."
  • Bananas:

    1. Clone
    2. Insert DNA
    3. ???
    4. Profit!

    Seriously, most strawberries are quadriploidal (4N), by design. They are larger this way, what about research in this direction? I'd be much angrier if there were no strawberries!
  • by Zukix ( 641813 ) on Thursday January 16, 2003 @08:16AM (#5093426)
    What crazy westerner decided that everyone prefers the typical banana? I happily munched wild bananas while trekking in Northern Thailand and goddam they're like a different fruit. Unimaginably sweet, fragrant...amazing - like nectar. Not the bland lumps sold in UK supermarkets. They are small (offending western male self-perception) and probably don't travel well so thank-you evil corporations for 'deciding' that we prefer this genetically weak alternative so they can make a buck. I hope they DO die out and we 'stuck' with REAL bananas. Zu.
    • UK supermarkets, indeed all supermarkets, are there to sell bland lumps. Doesn't matter what the product, it's got to be sanitized and regularized to make shopping in June the same as shopping in December.
  • by Alien Being ( 18488 ) on Thursday January 16, 2003 @08:27AM (#5093458)
    You fall down just looking at it.
  • by CaptainSuperBoy ( 17170 ) on Thursday January 16, 2003 @08:36AM (#5093475) Homepage Journal
    Dish > Banana > Ice cream > Chocolate syrup > Whipped cream > Sprinkles > Cherries > Spoon

    mmmmm...
  • by esme ( 17526 ) on Thursday January 16, 2003 @08:52AM (#5093531) Homepage
    Who would have thought that one of the most phallic foods was sterile and asexual?

    -Esme

  • by MoobY ( 207480 ) <anthony@liekensCURIE.net minus physicist> on Thursday January 16, 2003 @08:54AM (#5093540) Homepage
    It is not simply true that triploidal plants and animals have to replicate asexual. Cultivated bananas indeed do have 3 chromosomes of each of the 11 different chromosomes available. During meiosis, when two possible parent plants are creating gametes (think of sperm and eggs) by splitting cells with 3 chromosomes of each type into cells with either 1 or 2 of the 3 chromomes.

    In the next step, such gametes need to be fertilized, i.e., 2 cells, just like a sperm cell and egg cell, need to be fertilized and merged together. If this results in a cell with 3 chromosomes of each chromosome type, a new banana child can grow from this. But since gametes contain 1 or 2 of each type of chromosome, and they have 11 such types, there is only a 1/2^11 change that this sexual reproduction is succesful.

    Note that this only applies to the cultivated banana, as we know it from the super market. And you've probably never eaten a banana with pits in it. Bananas with pits exist, but there's only one in about 2048. These bananas can be used to create new banana trees, and they're different from their not-succesful bananas in that they are a lot smaller, and not edible, if compared to common cultivated bananas.
  • by Rik Sweeney ( 471717 ) on Thursday January 16, 2003 @09:10AM (#5093578) Homepage
    I think I'd go mad.

    Bananas even.
  • Scientists tried before to sequence banana, but they didn't know when to stop.
  • by Snorklefish ( 639711 ) on Thursday January 16, 2003 @09:24AM (#5093632)
    Genetic engineering is great, but no necessary for creating a better banana. The Honduran Foundation for Agricultural Research, known by its Spanish acronym(FHIA) has been breeding better bananas for years. Their first named banana, FHIA-01, better known as "Goldfinger" is likely to become the predominate supermarket variety in the next 10 years. I've grown it and its better than current basic supermarket varieties. For more info see http://www.idrc.ca/books/reports/V221/banana.html
  • Or is that a banana in your DNA sequencer?
  • "Go banana!" - Ralph Wiggum
  • by Muad'Dave ( 255648 ) on Thursday January 16, 2003 @10:46AM (#5094182) Homepage
    Frison says they won't be seeking genes that would make bananas straight. "It would take all the fun out of bananas," he says. "They'd be so boring."

    I guess Frison finds gay bananas much more interesting than straight bananas.

  • Because bananas are triploidal instead of diploidal, they are only able to reproduce asexually, which means that it adapts slower than organisms reproducing sexually.

    this means they must be geeks, and well, we all know geeks use linux.
  • I can't hear you! There's a gene sequence of a banana in my ear!!!

    Wakka-wakka-wakka!
  • Mmmm....genetically sequenced banana....
  • Completely off topic, but the fact that an organization called the International Network for the Improvement of Banana and Plantain exists in the first place is just mind-boggling to me. I think it means that this here new-fangled Internet thing has a way of connecting people....

    Yeah yeah, so it's a rather obvious point.

    --Mid
  • That's nuts.
  • more info at this site [slashdot.org]

    heh heh

    Travis
  • And when that rouge banna asextually spawns roots in my back yard, do I require a license for the genetic patents?
  • I didn't realize that bananas were so heavily dosed with poisons.

    I don't think I want to eat them any more. They can't be healthy for me.
  • 1. Banana plants are propagated from shoots taken from another banana plant.
    2. Bananas are by far the most heavily sprayed crop in the world.
    3. "Wild banana" would probably make a great name for a band.
  • ... on The Banana Splits show [freeserve.co.uk].

    Surely anyone here over the age of thirty-five remembers the theme song:

    One banana, two banana, three banana, four
    Four bananas make a bunch and so do many more
    Over hill and highway the banana buggies go
    Comin' to bring you the Banana Split show

Most people will listen to your unreasonable demands, if you'll consider their unacceptable offer.

Working...