Your Genome Scanned While You Wait 266
dotc writes "A Wired reporter has his DNA scanned for disease predispositions. While we all knew this was coming soon, it's still a little strange to read the first-person account."
Faith may be defined briefly as an illogical belief in the occurence of the improbable. - H. L. Mencken
Job Discrimination (Score:5, Funny)
More importantly when we go on dates?
Re:Job Discrimination (Score:5, Funny)
Re:Job Discrimination (Score:4, Funny)
Re:Job Discrimination (Score:2, Interesting)
I managed to dig up some stuff on it for anyone interested, my recolection is dim anyway.
Try The Single Chromosome's Guide To Dating [city.ac.uk]
Or the Google Text Conversion [google.ca]
Re:Job Discrimination (Score:3, Funny)
When I first read this, I thought it said "testicle samples". Which was funny, but then made the next line even funnier...
More importantly when we go on dates? :)
Gattica (Score:5, Funny)
Re:Gattica (Score:5, Informative)
Re:Gattica (Score:4, Funny)
Re:Gattica (Score:5, Funny)
Re:Gattica (Score:2)
Re:Gattica (Score:2)
Re:Gattica (Score:5, Insightful)
Gattica was an intresting movie, but there were a lot of things that did not make sense. For one thing, the genetic tests were omnipresent - they alone determined what job you would get and whom you would date. They even had to take genetic tests to get into work every day, and the company would search through its facilities to make sure that nobody with inferior genes was present.
On the other hand, the main character did not have 'improved' genes, and so he had to falsify his identity to get a job. However, he appeared to be just as competent as all the other people where he worked, perhaps more so. Therin lies the contradiction - why would corporations go through great lengths to exclude people with inferior genes, if those are not real indicators of performance?
A different scenario is that genetic manipulation really does make people smarter and more competent. But then this could probably be identified through normal tests and interviews.
I don't know which scenario is scarier.
Tor
Re:Gattica (Score:5, Insightful)
For much the same reason why corporations go to great lengths to exclude people without a 'good' education. They're social thought of as being superior people, even if they aren't. That was the gist of the movie.
Re:Gattica (Score:2)
Re:Gattica (Score:5, Interesting)
Gee, I don't know - wonder why some people thing black people are inferior just because they're black (or green, or gay or whatever). That's what prejudice is - basing a judgement of someone on something arbitrary rather than experience, education level, etc.
There was a great episode of "This American Life" [thislife.org] called Them [thislife.org] that talks about this, particularly the last story.
From the show's description of this last story:
Grab it. Give a listen.
Triv
Re:Gattica (Score:2)
Re:Gattica (Score:2, Insightful)
The question was would it be wise, not would it be immoral.
Re:Gattica (Score:2, Interesting)
However, there would be so many exceptions that for 20% of the population with "inferior" genes it would be useless discrimination, which is what the movie portrays.
Re:Gattica (Score:2)
They wouldn't. Gattaca was designed to be a shock-and-alarm film, scaring people with new technology ("I'll be screwed over because of my *genes*!"). Companies are quite dilligent on crunching the numbers on this -- this is why insurance companies can even exist.
On the other hand, if this *was* a real indicator of performance *in general*, the single person who's an exception to the rule could certainly be screwed over. The company isn't willing to hire because the evidence available says that the guy isn't going to be a good employee...but the same thing happens today, based on other data.
Frankly, I think that the "scariness" of genetic engineering and genetic testing has been way overblown, but...
Re:Gattica (Score:2)
It was about discrimination against people who probably WOULD be qualified, but didn't have the same opportunity based on their genes.
WHAT? Body scans?! (Score:4, Funny)
Re:WHAT? Body scans?! (Score:3, Funny)
Re:WHAT? Body scans?! (Score:2)
I did NOT mean to. My apologies for not being more careful.
RP
Moderation: Was Re:WHAT? Body scans?! (Score:2)
The moderation you made may have been removed simply by posting. The moderator guidelines don't specifically mention that action, but I thought I experienced it in the past.
The next news article (Score:5, Insightful)
Re:The next news article (Score:5, Interesting)
'Oh you might have a heart problem sometime in the future, even though you're treating the issues and being proactive, I'm sorry, we're going to have to increase your premium 400%'
IIRC, UC-Berkeley employees ended up suing some of the HMOs because they were unfairly rejecting African Americans because they carried a higher risk for high blood pressure, sickle cell, etc.
Nevermind the issues for the whole 'expression of the predisposition' and how accurate these readings are at this time.
Diagnostics, the double/triple edged sword. Wheee!
Re:The next news article (Score:2)
The really interesting future learning could come from massive data stores with thousands of people's genomes, family histories, and health records all being compared to more quickly isolate the functions of various SNPs.
Re:The next news article (Score:4, Interesting)
Let's not hang onto an old business model of a lottery system for healthcare and come up with a new paradigm that's more fair to all.
Re:The next news article (Score:2)
Exceptions to this often exist when an individual has behavior that increases his likelihood of high costs. Motorcycle stunt riders, lifetime smokers, and lion tamers should expect to pay more, since their behavior places them at higher risk of burdensome medical costs.
If we assess these high fees based on a person's identity, for example, skin color or genome content, it is no different than saying that "black people are likely to commit crimes, so round them up first when looking for a suspect." While you might actually catch a lot of criminals this way, it is hardly ethical or just.
In health insurance, unlike policing the citizenry, if you raise fees based on a person's identity rather than their behavior, they are likely to quit participating in the system, which decreases the combined financial pool, which increases the burden on you to pay for your medical costs. As long as a person can say, "If I quit smoking, I'll save money," they're far more likely to cough up the cash.
Group health care is a very interesting and finnicky instance of philosophy and economics. There are many things you cannot do in health care that is perfectly permissible in other areas due to the artificial communism that makes health care work.
Re:The next news article (Score:2)
This isn't as good as it sounds (Score:3, Insightful)
2) This won't just be used for diseases. You may remember in the movie Gattica there was one of these devices being used for personality analisis. How long before (even if made illegal) employers feed this information in about employees? People run their date's information through a computer to try and predict compatibility?
Re:This isn't as good as it sounds (Score:2, Funny)
Once the secret army of ashcroft deploys all the black helicopters in an effort to infiltrate the new world...oh wait, wrong site.
Re:This isn't as good as it sounds (Score:2)
Re:This isn't as good as it sounds (Score:3, Funny)
Some companies [budlight.com] bottle it...
What we all knew... (Score:2, Insightful)
But (Score:3, Funny)
This is very premature technology (Score:3, Insightful)
We don't know enough about the genetic code yet (whether we should even try to learn it is another debate, you need only look at how Western Society has been damaged by the results of invetigating the poor fertility of yam-eating Mexican Indians) to do more than rough guesses that are about as accurate as asking about your families medical history.
If you want to live longer, eat right, exercise and don't smoke. I'm sure our Pope will soon ban this useless exercise, anyhow.
Re:This is very premature technology (Score:5, Insightful)
Re:This is very premature technology (Score:3, Informative)
And they never will, because the cancer is very dependent on certain random events (incorrect cell duplications), and heart attacks on diet and amount of exercise.
Tor
Re:This is very premature technology (Score:2)
For that matter, there are enough diseases that are easy to treat if caught early but otherwise deadly that it's hard to check for all of them all the time. It's useful to be able to say that a certain person has to worry more about breast cancer than other things, and check for that more frequently.
Venter (Score:3, Informative)
Re:Venter (Score:4, Informative)
It's sort of the difference between reverse compiling the entire suorce code for an app (hard), and checking certain locations for passwords/corruption/etc.
G
Ps: Celera's map didn't really beat HUGO, they're both totally incomplete, with tons of errors known and unknown.
Re:Venter (Score:2)
Commonly known as decompiling.
BTW, Java is a language very well suited to decompilation, if you want to take a look at automated decompilers.
Genescope (Score:2)
Re:Genescope (Score:5, Funny)
Soon to be overheard... (Score:3, Funny)
"My genome is better than your genome!"
My Genes (Score:2, Funny)
Wow... (Score:5, Insightful)
Ramifications and Slashdot (Score:2)
Hell, do you understand the ramifications of posting to Slashdot entirely, particularly with a link to your homepage? The Wayback Machine and Google (and soon other places) are archiving what you're writing...you may well be building up an indelible record that future employers will *always* look at before considering you.
Uncertainty is part of life. If it wasn't...well, we'd have a much less interesting time.
Genetic predispositioning... (Score:5, Insightful)
You tell some people they are predispositioned for heart disease and they are going to think it is a death warrant. Even though it is only a chance, people will throw money at it in attempt to do something about it. More importantly this will spawn a whole new branch of medicine where you sell drugs/therapy to healthy people. We are already starting to see that practice today, look at the logic behind pepcid/ac, the heartburn medication you take over the counter *before* you have heartburn.
Just my two cents.
Re:Genetic predispositioning... (Score:3, Interesting)
Just a thought.
Needs to review his genetics (Score:5, Interesting)
CC is not an allowed base pairing. It could be GC, AT or TA instead, but CC would be recognized as a defect and repaired.
Re:Needs to review his genetics (Score:4, Informative)
say you have:
TGGCACATGCCTGTAATGCCAGCTACTTGGGAGGCTGAGGCA
and I have:
TGGCACATGCCTGTAATGCCAGCTACTTGGGAGGCTGAGGCA
we each have a paired strand that would match them, but the CG/CC difference could still change susceptibility to a disease
Re:Needs to review his genetics (Score:2)
And yes, I know a lot of people will see this as a nitpick, but damn it, this stuff is important.
Re:Needs to review his genetics (Score:2)
What Turing and DNA have in common (Score:2, Interesting)
Every hour, each E. coli bacterium multiplies by producing a copy of its DNA and then splitting into two daughter bacteria. Each is identical to its parent.
But, when protein diffusion is combined with the binding and release of proteins from the cell membrane, oscillating patterns in E. Coli occur.
Well, "Who cares?" you think to yourself.
However, it's actually fascinating because this is almost identical to the Turing model reaction-diffusion equations that you read about in your biology class(es); behind every set of zebra stripes or leopard spots lies this Turing model.
One page (Score:5, Informative)
Implications... (Score:3, Interesting)
Geography (Score:3, Interesting)
We check a map of Britain on his wall, and sure enough, the Sykes family's homeland of Yorkshire is less than 200 miles south of Perth.
Err...Britain's not really that all that big. 200 miles is considered a fair distance here. I'm from Yorkshire originally, and there's no way I would have considered Perth to be close.
I've sinced moved further south. It's 160 miles between where I came from (Sheffield in Yorkshire) and where I moved to (Marlow in Buckinghamshire). That too is considered a fair hop, although travelling that distance is something I'm completely used to now. But some of my friends in Yorkshire thing it's a long way to go.
All a difference of scale, really.
Cheers,
Ian
Re:Geography (Score:5, Funny)
My guess is that most of the readers here would willingly walk that distance if it meant getting laid.
Re:Geography (Score:3, Funny)
My guess is that most of the readers here
would willingly walk that distance if it
meant getting laid.
Well, I would walk 500 miles, and I would walk 500 more just to be the man who walked a thousand miles to fall down at her door.
Re:Geography - drifting off topic (Score:2)
I have had friends who live in Manhattan that consider 15 miles to be "far" and 200 miles to be an extraordinary distance to travel.
I wonder if people's definition of far is better correlated to "number of people passed" than "distance"?
Any slashdot readers from the Australian outback want to tell us what they think "far" is?
Hmm (Score:5, Insightful)
Re:Hmm (Score:5, Insightful)
What are insurance companies allowed to discriminate on:
Age? Yes.
Sex? Yes.
Smoker? Yes.
Race? No.
Relegion? No.
Occupation? Yes.
Licensed Private Pilot? Yes.
Credit Raiting? Yes.
Bungee Jumper? Yes.
Genetic Predisposition? Maybe!
In the end it's all numbers. If the numbers show people who wear blue shirts are more likely to get sick than those wearing red shirts... the insurance company should charge more to those in blue shirts. If you don't like this, go find another insurance company. It's legit to setup an insurance company that charges everyone excatly the same. If you're a 21 yr old smoker who flies ultralights, this might be the best bet for you. But if you're in perfect health and are extra careful with your self and have no predisposition, who are we to refuse this person the oppertunity to pay less. It's all gambling and knowing the odds changes the deal.
M@
Re:Hmm (Score:2)
Re:Hmm (Score:2)
If I ran an insurance company, and found that people born in the winter we're more likely to get sick, I'd charge them more.
It's all numbers... only question is which numbers you decide to use.
College education seems to be a very popular one these days.
M@
Re:Hmm (Score:3, Funny)
If the numbers show people who wear blue shirts are more likely to get sick than those wearing red shirts...
I always thought that it was the ones in the red shirts who died first.
Re:Hmm (Score:5, Insightful)
OK, let's say that the insurance companies can get prediction based on both genetics and lifestyle to the point where the money you pay them almost always exceeds the money they pay out for your health care, barring accidents, and even for accidents their lifestyle data gives them good insight into your probability of being hurt.
This would mean that, for the majority, insurance would become vastly more expensive, to the point where it would become unaffordable. The government would have to pick it up, and effectively tax the healthy to help pay. The alternative is just to leave more and more people with no insurance at all, which will quickly drop the US life expectancy down to third world levels. So you just wind up killing the concept of private insurance altogether. This might be a good thing.
Also notice that in countries with a single-payer system, good genetic screening is much less of a problem. Since the government system is going to pay to treat everyone anyway, knowing in advance who's susceptible to what diseases might actually reduce costs, by focusing the right treatment on the right people. So it might well be that it is this "Gattaca" stuff that finally kills the broken US health insurance system.
Re:Hmm (Score:3, Insightful)
Such a insurance company would cost much more and would make it inhibitable for lesser fortunate people to afford such luxury.
In a purely capitalistic society this would seem approriate.
But, at least to me, it seems unethical.
Why is it unethical to discriminate on basis of genetics?
To a similar reason, why it is unethical to discriminate on the basis on race, place of birth, zodiac sign.
First, the mantra "correlation is not cause" applies here to some extend, too. "You are black, so you will live shorter." is an example. In contrast, smokeing is unhealthy. That is a proven fact and not just a statistical correlation, like the decrease of the population of storks and a correlating decrease of the birthrate. Similar is currently true for genetic screenin.
As explained in the article, you may well have a predisposition in one gene for a certain malice, but it is far from known, how this may affect your life, as the same person may have some unknown genes, which compensate the predisposition.
Second, and more importantly: You can't choose your genetic make-up, where you're born and when.
Willingly punishing someone for such things is unethical.
At least according to my moral codex, which is the result of my upbringing. Maybe yours differ, but I thought the civilised world agreed upon this.
Re:Hmm (Score:2)
No it doesn't, it costs consumers (i.e., us) big money. In case you hadn't noticed, the insurance companies are making some quite nice profits, despite having to pay out now and then.
What the whole "insurance" argument comes down to is, we need to ask ourself if the current private-sector insurance "lottery" is the way we want to keep the industry running. That is, right now, they're insuring us based on the estimate that some of us will get heart disease, but there's no way to tell who, so they spread the cost around over everyone insured. Those who live healthy are really paying for those who know they're a big risk, and only signed up for insurance for free money.
Now personally, I'm Canadian, so I believe that it should be the job of the government to take care of those citizens who, through no fault of their own, inherited the Cystic Fibrosis gene or whatever. But under the current model, people basically expect free money from the insurance companies. Well, sorry, but there's no such thing as "free money." That money is coming out of the pockets of all the healthy people who will pay far more in than they'll ever get out.
Am I sharing again? (Score:5, Interesting)
Hard science journalism at it's best. Sheesh.
This, I'm told, is the first time a healthy human has ever been screened for the full gamut of genetic-disease markers.
Yeah, RIGHT. Imagine that lab meeting: Guys, I have a plan, we've never done this before, so lets invite in a journalist and see if we can humiliate ourselves.
Braun, 46, is both jovial and German.
Yes, Homer, Germany is the land of chocolate.
These disease-causing SNPs are fueling a biotech bonanza; the hope is that after finding them, the discoverers can design wonder drugs.
The hope of many of these bottom feeders is that they can identify an SNP and exert some intellectual property over it to horn in on whomever actually can find a treatment. Anyone want me to deliver another manifesto on the evil of this approach?
Alright - let's talk genetic diversity.
As Braun explains it, somewhere in the past, an isolated human community lived in an area where the food was poor in iron. Those who developed a mutation that stores high levels of iron survived, and those who didn't became anemic and died, failing to reproduce.
Good point! This is reason number one NOT to reduce the genetic diversity of the human race. All of these alleles floating around the population - which may become increasingly rare as there is selective pressure against them, and may even cause considerable suffering or death to some of those who carry them - should not be removed from our collective gene pool, at least not without considerable discussion. Why? Because WE MAY NEED THEM. A monoculture (were all organisms have the same genes) is not sustainable in a biological sense.
This is also one of the great tragedies of our times - sub-saharan africa contains only a fraction of the human population, but it contains over a third (depending on how you measure it) of human genetic diversity. The region of the world being devastated by AIDS may contain any number of alleles which our decsendents may need in the population in order to face the challenges of the future, whatever they may be.
"Ja, that's my favorite," says Braun, himself a smoker. "I wonder what Philip Morris would pay for that."
Note that this gene doesn't make it safe to smoke - smoking still causes heart disease and so forth in these people. Still, a treatment to clone this gene into your lungs could make billions, no (clone as in move DNA around)?
These genetic modification treatments may not be such a good idea, either. You all remember in 1999 when a research subject at Penn died from a liver treatment (search for "liver" [go.com])? The upshot is - anything that delivers genes into a person can, and sooner or later will, go out of control and do things you don't expect. Killing the subject is the most likely, but frankly least frightening, of these possibilities. The real threat - and my colleagues in biotech like to play this down but I am not at all convinced by their arguments - is that vectors for DNA delivery into humans could go wild and become contagious.
Of course, I'm opposed to animal organ transplantation for fear of introducing new human pathogens, so maybe I'm just a naysayer.
Re:Am I sharing again? (Score:2)
Have you read Greg Bear's book, Darwins Radio [gregbear.com]? The whole book is about evolution and a lot of it contemplates these types of circumstances.
Re:Am I sharing again? (Score:2, Informative)
And could you please elaborate on how animal organ transplants would introduce new human pathogens?
To respond briefly (Score:2)
HIV is generally agreed to have hopped from a monkey as a result of a bite. An animal organ - particularly when placed in an individual taking immunosuppressent drugs - might pose the same threat.
Bottlenecks (Score:2)
Someone else raised the possibility that I want to keep suffering people around as a genetic bank for the human race - that was not my intent. What I mean is that we should eliminate an allele from the population only after serious thought, and only if therapeutics fail, since we simply do not know (and cannot predict) which genes may be helpful to our descendents.
When those who are vulnerable to AIDS have died, there will be many alleles - which have nothing to do with AIDS - lost to the human race as a whole. Those alleles might have saved the human race - or some population of humans on some distant planet we colonised - from dying out under some other circumstance, or might have been linked to some other trait, important for some reason of which we have no inkling.
It is true that in order for the alleles in africa to be helpful to my descendents, I would need shared offspring, somewhere along the line, with a present day African. Since I am talking about a rather long timescale - millennia, at least - I view that as entirely likely. This reveals my multicultural social bias, I am sure; I am mixed Ashkinasi (Jew) and Cherokhee (American Indian.) If you asked my ancestors 1,000 years ago in the Baltics and the present-day SE US if they thought they'd share a great^40 grandchild, I think it would have looked pretty unlikely.
Tomorrow's slashdot post: (Score:2, Funny)
Y Chromosome and Surnames (Score:2, Interesting)
The fact that Sykes and I are members of the same extended family is just a bizarre coincidence, but it points to applications beyond simple genealogy. "I've been approached by the police to use my surnames data to match up with DNA from an unknown suspect found at a crime scene," says Sykes. Distinctive genetic markers can be found at the roots of many family trees. "This is possible, to narrow down a pool of suspects to a few likely surnames. But it's not nearly ready yet."
It had never occured to me that Y chromosome passes along from father to son would be almost identical, following surnames as they are passed on as well. It seems obvious, thinking about it however.
Im not sure I like the idea of possibly being hauled in for questioning because some messed-up branch of my lineage decided to go rob a liquor store to pay off his bookie. Of course, my family blood is too good to worry about such things!
Scott.
Re:Y Chromosome and Surnames (Score:2)
Diseases (Score:2, Interesting)
My DNA test.. (Score:5, Funny)
.. The last time I was at my physician he wanted a blood sample, a semen sample, a urine sample and a stool sample.
So I gave him my underwear.
[rimshot]
We're doomed! (Score:2)
Behold the Fordian Society of Huxley's "Brave New World" written in the 30s he warned of this day. Now it's finally here...
It's the end of the world as we know it, but I don't feel fine... not at all...
Re:We're doomed! (Score:2)
Doubtful. If anything it'll take those folks down a notch. The article touches on the fact that we all have some sort of mixed ancestry; "We are all mutts".
What happens when the KKK weirdos discover they have (which in all likelyhood they do) have Aferican or *gasp* Jewish ancestry?
More likely the danger would be in non-minority people discovering faint genetic traces of minority blood lines and abusing that fact to gain special privlidges they otherwise wouldn't be able to receive (or deserve).
On another note, you have to wonder about what the insurance companies would do about this. On the one hand, it seems likely they would raise premiums on those with genomes with a higher predisposition towards certian deseases. On the other hand, one could assume that in the interests of profits insurance companies would push for cheaper gene thearpy to remove potentially dangerous mutations before they lead to expensive medical positions.
I could easily see a day where insurance companies encourage (or perhaps even mandate) an analysis of DNA shortly after conception and modify the geneitics of the new life while it's still just a few cells. The logic is simple: Spend $5k to remove defects to save $100k in 40 years.
It could be very scary, or it could be very benificial. Now is the time to watch the lawmakers very, very carefully.
My take on this (Score:4, Insightful)
About the Author (Score:3, Informative)
It was so much easier.. (Score:5, Funny)
.. back in my granddad's day when you could just discriminate based on skin colour. Now you have to be a damn scientist to hate people.
Yes, I'm joking!
father/children (Score:2)
or not. These types of genetic checks have interesting side-effects, such as finding out that your father is not who you think he was! I read somewhere that this was the case in about 25% of cases. The future will bring us lots of fun!
I woudn't worry too much about it (Score:2, Interesting)
Anyway, there are many companies even now who don't recruit the brightest people. The reason, the brighter they are, the more likely they are to switch jobs. I kid you not but many companies have this policy, or used to do in dotcom era.
Besides, if you have too many smart people working at the same place, I think that wud create mayhem...just think of the arguments these guys can have...
So I will say guys, rest assured...we are safe
Why is everyone so negative? (Score:4, Insightful)
So it is creepy to get a genetic test, but also it can be quite useful. If you have predisposition for an illness then you are much better off knowing it in advance so that you can test frequently and adapt your behavior (e.g., diet).
And of course, if you still don't like it, you don't have to.
Now somebody will predict that insurance companies will force everyone to do the test, I'll save you the trouble and reply right away. The scenario is unlikely, because there are quite a few legal limitations on what these companies can and cannot ask for - and the majority of registered voters are very sceptical.
But even if it did happen, would it necessarily be so bad? Widespread testing would make the total, and therefore the average, cost of insurance lower. This is because it is easier and cheaper to treat illnesses at an early stage. Certainly those with certain predispositions would get a higher premium, but would not even that be preferable over paying a standard premium and then getting an illness that could have been averted by frequent tests and say the right diet? One could also think of taxes and subsidies supporting those that got higher premiums. Since the total medical costs would go down, it is at least theoretically possible to come up with a system where everyone is better off.
Tor
Genetic immunity to HIV? (Score:2)
From the article:
The SNPs keep rolling past, revealing more mutations, including a type-2 diabetes susceptibility, which tells me I may want to steer clear of junk food. More bad news: I don't have a SNP called CCR5 that prevents me from acquiring HIV, nor one that seems to shield smokers from lung cancer. "Ja, that's my favorite," says Braun, himself a smoker. "I wonder what Philip Morris would pay for that."
Hearing about CCR5 was the only thing in this article that blew my socks off. Genetic immunity to HIV? Wow.
Google hits a lot of things when doing a search for CCR5. The most approachable is here [arizona.edu].
Re:Genetic immunity to HIV? (Score:3, Funny)
So, it's a buffer overflow exploit, then?
Tracing Ancestors (Score:2, Interesting)
Dr. Mephesto, take a note (Score:2, Funny)
OMG, I didn't think that was possible! What will genetics bring us next?!?
Smokers rejoyce! (Score:5, Funny)
"One gene seems to shield smokers from lung cancer. 'That's my favorite,' says the doctor, a smoker. 'I wonder what Philip Morris would pay for that.'"
Ah yes.. now I can blisfully tell myself that yes I must have this gene and therfore my smoking is A.O.K
Huzzah!
The good news is... (Score:2)
In short, it's both nature and nurture. Try to be good to yourself...
Oh yeah, eat your goddam veggies, too, ya little bastards.
this is not accurate, it is a prediction. (Score:2)
Re:This is not fair use... (Score:2, Insightful)
Re:This is not fair use... (Score:2)
Re:This is not fair use... (Score:2)
This sort of thing happens all the time in academia... it's perfectly legal and in accordance with fair use. Just beacuse slashdot doesn't happen to be an educational institution doesn't mean that the article's duplication doesn't further education.
Re:This is not fair use... (Score:2)
There are four criteria determining whether something is fair use. First is the purpose -- commercial or non-profit educational. (There *are* differences between Slashdot and a university.) Second is the nature of the work. Third is the amount of quoted material (copying the whole article is less likely to be fair use than quoting a section.) Fourth is the competition for the market of the original publisher -- and Slashdot has a great overlap with Wired's audience, and fewer people will visit Wired's website because of this posting on Slashdot. Fair use can be pretty fuzzy sometimes, but not in this case.
Re:Gattaca (Score:2)
Gov't isn't the big threat. It is a threat mostly when it is being a hired bully for the corps.
If a "Gattaca" future becomes a reality, it will be the corporations, not the gov't, pushing for it and implementing it.
It doesn't matter if the gov't doesn't oppress you but no one will hire you, you'll starve anyway.