Forgot your password?
typodupeerror
Science

Your Genome Scanned While You Wait 266

dotc writes "A Wired reporter has his DNA scanned for disease predispositions. While we all knew this was coming soon, it's still a little strange to read the first-person account."
This discussion has been archived. No new comments can be posted.

Your Genome Scanned While You Wait

Comments Filter:
  • by MCMLXXVI ( 601095 ) on Thursday October 17, 2002 @12:05PM (#4470020)
    When will we have to make sure we leave no testable samples of DNA when going in for an interview?
    More importantly when we go on dates? :)
  • Gattica (Score:5, Funny)

    by Hayzeus ( 596826 ) on Thursday October 17, 2002 @12:06PM (#4470034) Homepage
    ...is just a few years away. On the upside, GE should render those "add three inches..." spams pretty much obsolete for my grandchildren.
    • Re:Gattica (Score:5, Informative)

      by efatapo ( 567889 ) on Thursday October 17, 2002 @12:20PM (#4470180)
      Normally I wouldn't correct spelling. But it's "GATTACA". Get it? Guanine, Adenosine, Thymine, Cytosine. Those are the nucleotides that make up DNA. There's a reason for the name. Just thought I'd point that out.
    • Re:Gattica (Score:5, Insightful)

      by f97tosc ( 578893 ) on Thursday October 17, 2002 @12:20PM (#4470183)
      Well, actually it is quite some ways, they have to go from checking to manipulation.

      Gattica was an intresting movie, but there were a lot of things that did not make sense. For one thing, the genetic tests were omnipresent - they alone determined what job you would get and whom you would date. They even had to take genetic tests to get into work every day, and the company would search through its facilities to make sure that nobody with inferior genes was present.

      On the other hand, the main character did not have 'improved' genes, and so he had to falsify his identity to get a job. However, he appeared to be just as competent as all the other people where he worked, perhaps more so. Therin lies the contradiction - why would corporations go through great lengths to exclude people with inferior genes, if those are not real indicators of performance?

      A different scenario is that genetic manipulation really does make people smarter and more competent. But then this could probably be identified through normal tests and interviews.

      I don't know which scenario is scarier.

      Tor
      • Re:Gattica (Score:5, Insightful)

        by Anonymous Coward on Thursday October 17, 2002 @12:27PM (#4470240)
        "Therin lies the contradiction - why would corporations go through great lengths to exclude people with inferior genes, if those are not real indicators of performance?"

        For much the same reason why corporations go to great lengths to exclude people without a 'good' education. They're social thought of as being superior people, even if they aren't. That was the gist of the movie.
      • Re:Gattica (Score:5, Interesting)

        by Triv ( 181010 ) on Thursday October 17, 2002 @12:43PM (#4470368) Journal
        Therin lies the contradiction - why would corporations go through great lengths to exclude people with inferior genes, if those are not real indicators of performance?

        Gee, I don't know - wonder why some people thing black people are inferior just because they're black (or green, or gay or whatever). That's what prejudice is - basing a judgement of someone on something arbitrary rather than experience, education level, etc.

        There was a great episode of "This American Life" [thislife.org] called Them [thislife.org] that talks about this, particularly the last story.

        From the show's description of this last story:
        Act III: Newfies. Reporter Chris Brookes had always thought the story was a joke. During World War II, a black sailor from the U.S. washed up nearly dead onshore in Newfoundland, and the white nurses -- never having seen a black man -- thought he was covered in oil and tried to scrub him clean. But when Brookes finally tracked the sailor down, decades later, it turned the whole thing was true. And the sailor said that sort of treatment was a lot nicer than what he'd been used to at the hands of whites down south. Brookes tells the incredible story of the sailor, Lanier Phillips, and how his experience in Newfoundland changed his life.


        Grab it. Give a listen. :)

        Triv
      • It wasn't that they were using genetic testing to keep 'inferior' people out, the genetic testing is an identification method, like retina scans and the such.
      • Re:Gattica (Score:2, Insightful)

        by jimmyCarter ( 56088 )
        Think beyond the job skills scenario a little -- if a corporation had the blueprints to the DNA of every employee and discovered that one of the employees had a predisposition to lung cancer, would it be wise to spend money on training and associated other job costs for said employee?

        The question was would it be wise, not would it be immoral.
      • Re:Gattica (Score:2, Interesting)

        by yakovlev ( 210738 )
        The theory is that it's a percentages game. If 80% of people with "superior" genes are capable and 80% of people wih "inferior" genes are incapable, then it makes sense statistically to do gene screening. Sure, there are people who don't fit the mold, but it would probably be more accurate than interviews.

        However, there would be so many exceptions that for 20% of the population with "inferior" genes it would be useless discrimination, which is what the movie portrays.
      • why would corporations go though great lengths to exclude people with inferior genes, if these are not real indicators of performance

        They wouldn't. Gattaca was designed to be a shock-and-alarm film, scaring people with new technology ("I'll be screwed over because of my *genes*!"). Companies are quite dilligent on crunching the numbers on this -- this is why insurance companies can even exist.

        On the other hand, if this *was* a real indicator of performance *in general*, the single person who's an exception to the rule could certainly be screwed over. The company isn't willing to hire because the evidence available says that the guy isn't going to be a good employee...but the same thing happens today, based on other data.

        Frankly, I think that the "scariness" of genetic engineering and genetic testing has been way overblown, but...
  • by gpinzone ( 531794 ) on Thursday October 17, 2002 @12:06PM (#4470038) Homepage Journal
    You mean I've been collecting Jude Law's blood and urine samples all these years for nothing?!
    • If you had bothered to test them you would've seen he was mecha.
    • I am TERRIBLY sorry. I'm a moderator and I intended ot moderate this up (Funny), but it appears that my mouse let me down and I actually selected the next option down, which is "Overrated", so I moderated the guy down.

      I did NOT mean to. My apologies for not being more careful.

      RP
      • Doesn't posting on the same article that you've recently moderated 'throw away' your moderation? You can't moderate and post on the same article (tends to allow bias).

        The moderation you made may have been removed simply by posting. The moderator guidelines don't specifically mention that action, but I thought I experienced it in the past.
  • by Drunken Coward ( 574991 ) on Thursday October 17, 2002 @12:06PM (#4470039)
    And of course, the next news article will be that HMO's have begun rejecting medical procedures based on the predisposition for certain diseases of certain genomes.
    • by foolish ( 46697 ) on Thursday October 17, 2002 @12:13PM (#4470109)
      Since they've already done this for every other type of testing result in the past, that's hardly a suprise right?

      'Oh you might have a heart problem sometime in the future, even though you're treating the issues and being proactive, I'm sorry, we're going to have to increase your premium 400%'

      IIRC, UC-Berkeley employees ended up suing some of the HMOs because they were unfairly rejecting African Americans because they carried a higher risk for high blood pressure, sickle cell, etc.

      Nevermind the issues for the whole 'expression of the predisposition' and how accurate these readings are at this time.

      Diagnostics, the double/triple edged sword. Wheee!

      • I think that you could fairly make a case that until the entire genome is reasonably understood and we have a huge database of data from which to calculate percentages, genetic indicators alone are not enough proof for rejection.

        The really interesting future learning could come from massive data stores with thousands of people's genomes, family histories, and health records all being compared to more quickly isolate the functions of various SNPs.
      • by gpinzone ( 531794 ) on Thursday October 17, 2002 @01:31PM (#4470844) Homepage Journal
        On the flip side, why should I pay higher Insurance rates for your heart attack? The whole idea of insurance is to guard against the unknown. It ceases to be a useful model of healthcare reimbursement when the ability to predict health problems becomes a reality.

        Let's not hang onto an old business model of a lottery system for healthcare and come up with a new paradigm that's more fair to all.
        • The point of group insurance is to ameliorate the costs of any individual's costs among the entire group. This system works best when we all pay the same amount, therefore we all get the same amount of unknown, future protection.

          Exceptions to this often exist when an individual has behavior that increases his likelihood of high costs. Motorcycle stunt riders, lifetime smokers, and lion tamers should expect to pay more, since their behavior places them at higher risk of burdensome medical costs.

          If we assess these high fees based on a person's identity, for example, skin color or genome content, it is no different than saying that "black people are likely to commit crimes, so round them up first when looking for a suspect." While you might actually catch a lot of criminals this way, it is hardly ethical or just.

          In health insurance, unlike policing the citizenry, if you raise fees based on a person's identity rather than their behavior, they are likely to quit participating in the system, which decreases the combined financial pool, which increases the burden on you to pay for your medical costs. As long as a person can say, "If I quit smoking, I'll save money," they're far more likely to cough up the cash.

          Group health care is a very interesting and finnicky instance of philosophy and economics. There are many things you cannot do in health care that is perfectly permissible in other areas due to the artificial communism that makes health care work.

  • by Anonymous Coward on Thursday October 17, 2002 @12:07PM (#4470046)
    1) People will take predispositions too seriously. People with 'bad' genes will think they're doomed and live like it. People without any 'bad' genes will think they're bulletproof and live like it.
    2) This won't just be used for diseases. You may remember in the movie Gattica there was one of these devices being used for personality analisis. How long before (even if made illegal) employers feed this information in about employees? People run their date's information through a computer to try and predict compatibility?
  • by norcal ( 461428 )
    ...was that this was coming. The question now are, when and will people accept this as a moral practice, or reject it as something unethical.
  • But (Score:3, Funny)

    by vasah20 ( 530238 ) on Thursday October 17, 2002 @12:08PM (#4470053) Homepage
    ... we all earned from Bart in episode 2F20 [snpp.com] (The conclusion to "Maggie Shot Mr. Burns") that no court would ever accept DNA evidence!
  • by Adam Rightmann ( 609216 ) on Thursday October 17, 2002 @12:08PM (#4470055)
    Sure, you can find a few statistical correlations between a few very dangerous diseases and genetic markers, but as the story points out, they still don't know enough to say for certain that a person will get breast cancer at age 47 1/2, or have a heart attack at 53 while climbing 3 flights of stairs.

    We don't know enough about the genetic code yet (whether we should even try to learn it is another debate, you need only look at how Western Society has been damaged by the results of invetigating the poor fertility of yam-eating Mexican Indians) to do more than rough guesses that are about as accurate as asking about your families medical history.

    If you want to live longer, eat right, exercise and don't smoke. I'm sure our Pope will soon ban this useless exercise, anyhow.
    • by zeoslap ( 190553 ) on Thursday October 17, 2002 @12:28PM (#4470248) Homepage
      First off he's not my pope. Secondly it's far from useless, understanding who we are has been a driving force for positive change through the ages, lets not kid ourselves into thinking that knowledge is a bad thing...
    • Sure, you can find a few statistical correlations between a few very dangerous diseases and genetic markers, but as the story points out, they still don't know enough to say for certain that a person will get breast cancer at age 47 1/2, or have a heart attack at 53 while climbing 3 flights of stairs.

      And they never will, because the cancer is very dependent on certain random events (incorrect cell duplications), and heart attacks on diet and amount of exercise.

      Tor
    • We'll never be able to predict that sort of thing from genetics, because environment matters a lot more than genetics. It's just that genetics matters some, and it's relatively easy to research accurately. At most, genetics is going to tell you what you're likely to die of if you do nothing to change it, and it could be useful in telling you which ways it would be wise to shift your risk factors. It's probably good to know whether you have to worry about malaria or having anemic children, for instance.

      For that matter, there are enough diseases that are easy to treat if caught early but otherwise deadly that it's hard to check for all of them all the time. It's useful to be able to say that a certain person has to worry more about breast cancer than other things, and check for that more frequently.
  • Venter (Score:3, Informative)

    by Anonymous Coward on Thursday October 17, 2002 @12:08PM (#4470062)
    I read that J. Craig Venter (owner of Celera, who beat the HUGO project to sequence the human genome) sells the opportunity to have your own genome sequenced for 500,000$
    • Re:Venter (Score:4, Informative)

      by genomancer ( 588755 ) on Thursday October 17, 2002 @12:58PM (#4470489)
      What Celera/Ventner are selling for .5M is having your genome SEQUENCED, not scanned. The former is a base-pair level map of your entire genome. The latter is checking certain windows to see if they contain a known, small, problem causing mutation, (as well as some large checks for rearrangements and such).

      It's sort of the difference between reverse compiling the entire suorce code for an app (hard), and checking certain locations for passwords/corruption/etc.

      G

      Ps: Celera's map didn't really beat HUGO, they're both totally incomplete, with tons of errors known and unknown.
      • reverse compiling

        Commonly known as decompiling.

        BTW, Java is a language very well suited to decompilation, if you want to take a look at automated decompilers.
  • How far into the future is the Genescope from Michael Cordy's books, a device that, among other things, can show a real life image of someone constructed from his/her DNA?
    • by Gorm the DBA ( 581373 ) on Thursday October 17, 2002 @12:20PM (#4470175) Journal
      Not all that close, when you consider that DNA knows nothing about what's happened to you since birth in terms of did you lose an eye in a tragic carrot eating accident, or do you have a scar on your left forearm from that attack by the killer monkeys, or anything else that is nurture over nature.

  • by azadrozny ( 576352 ) on Thursday October 17, 2002 @12:12PM (#4470093)
    ... on school playgrounds everywhere:
    "My genome is better than your genome!"
  • My Genes (Score:2, Funny)

    by conduit4 ( 589726 )
    My jeans get scaned everytime I walk down the street and the ladys check out my ass.
  • Wow... (Score:5, Insightful)

    by KenCrandall ( 13860 ) on Thursday October 17, 2002 @12:12PM (#4470098) Homepage
    Did anyone other than me just get *TOTALLY* creeped-out by that article? Not the Gattica references, although the social implications are staggering (i.e. the Philip-Morris quote), but more of the feeling that knowing all the things about my body that *could* go wrong, and trying to treat them in advance is just something that we don't understand the ramifications of entirely?
    • just something that we don't understand the ramifications of entirely?

      Hell, do you understand the ramifications of posting to Slashdot entirely, particularly with a link to your homepage? The Wayback Machine and Google (and soon other places) are archiving what you're writing...you may well be building up an indelible record that future employers will *always* look at before considering you.

      Uncertainty is part of life. If it wasn't...well, we'd have a much less interesting time.
  • by UnidentifiedCoward ( 606296 ) on Thursday October 17, 2002 @12:16PM (#4470133)
    is *NOT* the same as actually being diseased/sick. Just because you carry a ressive trait for diabetes or heart disease does not mean that you will suffer from either. I already know I am "predisposed to heartdisease and diabetes", my grandfather had it. I do not need a DNA scan to tell me.

    You tell some people they are predispositioned for heart disease and they are going to think it is a death warrant. Even though it is only a chance, people will throw money at it in attempt to do something about it. More importantly this will spawn a whole new branch of medicine where you sell drugs/therapy to healthy people. We are already starting to see that practice today, look at the logic behind pepcid/ac, the heartburn medication you take over the counter *before* you have heartburn.

    Just my two cents.
    • While I agree with you to some extent, what if your grandfather brought about his own diseased heart? You would not have a predisposition to it from him (although you might from other members of your family tree that never actually suffered heart disease). You might be fooling yourself into thinking that not smoking and drinking lots of anticarcinogens is helping you, not knowing that your great-great-great-grandma had a hell of an alcoholism/adictivism kick in her gene pool that drinking all that red wine is plugging into.
      Just a thought.
  • by sacremon ( 244448 ) on Thursday October 17, 2002 @12:18PM (#4470151)
    "For instance, you might have a CG that makes you susceptible to diabetes, and I might have a CC, which makes it far less likely I will get this disease."

    CC is not an allowed base pairing. It could be GC, AT or TA instead, but CC would be recognized as a defect and repaired.
    • by Dambiel ( 115695 ) on Thursday October 17, 2002 @12:25PM (#4470230) Homepage
      he's talking about single strand bases, not pairing

      say you have:
      TGGCACATGCCTGTAATGCCAGCTACTTGGGAGGCTGAGGCAG GAGAAT CG CTTGAACCT

      and I have:
      TGGCACATGCCTGTAATGCCAGCTACTTGGGAGGCTGAGGCAG GAGAAT CC CTTGAACCT

      we each have a paired strand that would match them, but the CG/CC difference could still change susceptibility to a disease
      • That might be what he meant, but the way the article was written, it certainly sounded like he thought the CC might be a base pair. Would have been better if he hadn't used one good base pair (CG) and one bad one (CC) in the example.

        And yes, I know a lot of people will see this as a nitpick, but damn it, this stuff is important.
        • Of course he should be using triplets, not pairs. Two bases on their own are meaningless,3 bases mean a particular amino acid (or stop). Going from CGA to CCA would result in a alanine being replaced by a glycine. Going from GCG to GCC would result in arginine either way, so would be harmless.
  • All this talk about DNA had me thinking not only about mapping the human genome, but the very processes through which other organisms replicated and pass-on this DNA "code" to their very existance.

    Every hour, each E. coli bacterium multiplies by producing a copy of its DNA and then splitting into two daughter bacteria. Each is identical to its parent.

    But, when protein diffusion is combined with the binding and release of proteins from the cell membrane, oscillating patterns in E. Coli occur.

    Well, "Who cares?" you think to yourself.

    However, it's actually fascinating because this is almost identical to the Turing model reaction-diffusion equations that you read about in your biology class(es); behind every set of zebra stripes or leopard spots lies this Turing model.
  • One page (Score:5, Informative)

    by Klerck ( 213193 ) on Thursday October 17, 2002 @12:18PM (#4470155) Homepage
  • Implications... (Score:3, Interesting)

    by jaredcoleman ( 616268 ) on Thursday October 17, 2002 @12:19PM (#4470171)
    DNA scanning will fan the flames of the fetus rights debate, as parents desire to alter the DNA of unborn children.
  • Geography (Score:3, Interesting)

    by mccalli ( 323026 ) on Thursday October 17, 2002 @12:24PM (#4470214) Homepage
    I do like the section where he finds he's genetically similar to the geneticist testing him....

    We check a map of Britain on his wall, and sure enough, the Sykes family's homeland of Yorkshire is less than 200 miles south of Perth.

    Err...Britain's not really that all that big. 200 miles is considered a fair distance here. I'm from Yorkshire originally, and there's no way I would have considered Perth to be close.

    I've sinced moved further south. It's 160 miles between where I came from (Sheffield in Yorkshire) and where I moved to (Marlow in Buckinghamshire). That too is considered a fair hop, although travelling that distance is something I'm completely used to now. But some of my friends in Yorkshire thing it's a long way to go.

    All a difference of scale, really.

    Cheers,
    Ian

    • by Gruneun ( 261463 ) on Thursday October 17, 2002 @12:37PM (#4470323)
      200 miles is considered a fair distance here.

      My guess is that most of the readers here would willingly walk that distance if it meant getting laid.
      • 200 miles is considered a fair distance here.

        My guess is that most of the readers here
        would willingly walk that distance if it
        meant getting laid.


        Well, I would walk 500 miles, and I would walk 500 more just to be the man who walked a thousand miles to fall down at her door.
    • I am always surprised at the distance distortion that occurs in areas of high population density. I live in the middle of the United States (< 60 miles from the population centroid) and don't think twice about driving 500 miles to my vacation cabin. (Too d*mn hot where I live in the summer. Got to go north.)

      I have had friends who live in Manhattan that consider 15 miles to be "far" and 200 miles to be an extraordinary distance to travel.

      I wonder if people's definition of far is better correlated to "number of people passed" than "distance"?

      Any slashdot readers from the Australian outback want to tell us what they think "far" is?
  • Hmm (Score:5, Insightful)

    by Rogerborg ( 306625 ) on Thursday October 17, 2002 @12:24PM (#4470223) Homepage
    I wonder how long before we hear: Only those with something to hide would refuse to be screened. Using encryption (for example) just pisses off government, but there's nobody with deep pockets brib^H^H^H^H lobbying them to ban it. But insuring sickly people costs insurers big money. How much would it cost them to buy laws to make screening mandatory, or at least to allow them (all of them) to insist on it if you want a policy? At the least, I expect to see policy rises for those who refuse a screening, on the basis that only those with something to hide...
    • Re:Hmm (Score:5, Insightful)

      by msheppard ( 150231 ) on Thursday October 17, 2002 @12:50PM (#4470422) Homepage Journal
      Flip side: What if I get screened, show up super-clean, and want to pay less for health insurance? Shouldn't I be allowed to contract with an insurance company that only insures those that are screened?

      What are insurance companies allowed to discriminate on:
      Age? Yes.
      Sex? Yes.
      Smoker? Yes.
      Race? No.
      Relegion? No.
      Occupation? Yes.
      Licensed Private Pilot? Yes.
      Credit Raiting? Yes.
      Bungee Jumper? Yes.
      Genetic Predisposition? Maybe!

      In the end it's all numbers. If the numbers show people who wear blue shirts are more likely to get sick than those wearing red shirts... the insurance company should charge more to those in blue shirts. If you don't like this, go find another insurance company. It's legit to setup an insurance company that charges everyone excatly the same. If you're a 21 yr old smoker who flies ultralights, this might be the best bet for you. But if you're in perfect health and are extra careful with your self and have no predisposition, who are we to refuse this person the oppertunity to pay less. It's all gambling and knowing the odds changes the deal.

      M@
      • by Peyna ( 14792 )
        I kinda wonder about the race one, since some races of people are more susceptible to certain diseases and thus a higher risk in some categories.
      • Re:Hmm (Score:3, Funny)

        by runlvl0 ( 198575 )

        If the numbers show people who wear blue shirts are more likely to get sick than those wearing red shirts...

        I always thought that it was the ones in the red shirts who died first.

      • Re:Hmm (Score:5, Insightful)

        by JoeBuck ( 7947 ) on Thursday October 17, 2002 @01:55PM (#4471058) Homepage

        OK, let's say that the insurance companies can get prediction based on both genetics and lifestyle to the point where the money you pay them almost always exceeds the money they pay out for your health care, barring accidents, and even for accidents their lifestyle data gives them good insight into your probability of being hurt.

        This would mean that, for the majority, insurance would become vastly more expensive, to the point where it would become unaffordable. The government would have to pick it up, and effectively tax the healthy to help pay. The alternative is just to leave more and more people with no insurance at all, which will quickly drop the US life expectancy down to third world levels. So you just wind up killing the concept of private insurance altogether. This might be a good thing.

        Also notice that in countries with a single-payer system, good genetic screening is much less of a problem. Since the government system is going to pay to treat everyone anyway, knowing in advance who's susceptible to what diseases might actually reduce costs, by focusing the right treatment on the right people. So it might well be that it is this "Gattaca" stuff that finally kills the broken US health insurance system.

      • Re:Hmm (Score:3, Insightful)

        by Yokaze ( 70883 )
        > If you don't like this, go find another insurance company.

        Such a insurance company would cost much more and would make it inhibitable for lesser fortunate people to afford such luxury.

        In a purely capitalistic society this would seem approriate.
        But, at least to me, it seems unethical.
        Why is it unethical to discriminate on basis of genetics?

        To a similar reason, why it is unethical to discriminate on the basis on race, place of birth, zodiac sign.

        First, the mantra "correlation is not cause" applies here to some extend, too. "You are black, so you will live shorter." is an example. In contrast, smokeing is unhealthy. That is a proven fact and not just a statistical correlation, like the decrease of the population of storks and a correlating decrease of the birthrate. Similar is currently true for genetic screenin.
        As explained in the article, you may well have a predisposition in one gene for a certain malice, but it is far from known, how this may affect your life, as the same person may have some unknown genes, which compensate the predisposition.

        Second, and more importantly: You can't choose your genetic make-up, where you're born and when.
        Willingly punishing someone for such things is unethical.
        At least according to my moral codex, which is the result of my upbringing. Maybe yours differ, but I thought the civilised world agreed upon this.
    • Insuring sickly people costs insurers big money.


      No it doesn't, it costs consumers (i.e., us) big money. In case you hadn't noticed, the insurance companies are making some quite nice profits, despite having to pay out now and then.

      What the whole "insurance" argument comes down to is, we need to ask ourself if the current private-sector insurance "lottery" is the way we want to keep the industry running. That is, right now, they're insuring us based on the estimate that some of us will get heart disease, but there's no way to tell who, so they spread the cost around over everyone insured. Those who live healthy are really paying for those who know they're a big risk, and only signed up for insurance for free money.

      Now personally, I'm Canadian, so I believe that it should be the job of the government to take care of those citizens who, through no fault of their own, inherited the Cystic Fibrosis gene or whatever. But under the current model, people basically expect free money from the insurance companies. Well, sorry, but there's no such thing as "free money." That money is coming out of the pockets of all the healthy people who will pay far more in than they'll ever get out.

  • Am I sharing again? (Score:5, Interesting)

    by sam_handelman ( 519767 ) <samuel.handelman ... .com minus punct> on Thursday October 17, 2002 @12:37PM (#4470318) Journal
    DNA is the book of life. It's also the book of death.

    Hard science journalism at it's best. Sheesh.

    This, I'm told, is the first time a healthy human has ever been screened for the full gamut of genetic-disease markers.

    Yeah, RIGHT. Imagine that lab meeting: Guys, I have a plan, we've never done this before, so lets invite in a journalist and see if we can humiliate ourselves.

    Braun, 46, is both jovial and German.

    Yes, Homer, Germany is the land of chocolate.

    These disease-causing SNPs are fueling a biotech bonanza; the hope is that after finding them, the discoverers can design wonder drugs.

    The hope of many of these bottom feeders is that they can identify an SNP and exert some intellectual property over it to horn in on whomever actually can find a treatment. Anyone want me to deliver another manifesto on the evil of this approach?

    Alright - let's talk genetic diversity.
    As Braun explains it, somewhere in the past, an isolated human community lived in an area where the food was poor in iron. Those who developed a mutation that stores high levels of iron survived, and those who didn't became anemic and died, failing to reproduce.

    Good point! This is reason number one NOT to reduce the genetic diversity of the human race. All of these alleles floating around the population - which may become increasingly rare as there is selective pressure against them, and may even cause considerable suffering or death to some of those who carry them - should not be removed from our collective gene pool, at least not without considerable discussion. Why? Because WE MAY NEED THEM. A monoculture (were all organisms have the same genes) is not sustainable in a biological sense.

    This is also one of the great tragedies of our times - sub-saharan africa contains only a fraction of the human population, but it contains over a third (depending on how you measure it) of human genetic diversity. The region of the world being devastated by AIDS may contain any number of alleles which our decsendents may need in the population in order to face the challenges of the future, whatever they may be.

    "Ja, that's my favorite," says Braun, himself a smoker. "I wonder what Philip Morris would pay for that."

    Note that this gene doesn't make it safe to smoke - smoking still causes heart disease and so forth in these people. Still, a treatment to clone this gene into your lungs could make billions, no (clone as in move DNA around)?

    These genetic modification treatments may not be such a good idea, either. You all remember in 1999 when a research subject at Penn died from a liver treatment (search for "liver" [go.com])? The upshot is - anything that delivers genes into a person can, and sooner or later will, go out of control and do things you don't expect. Killing the subject is the most likely, but frankly least frightening, of these possibilities. The real threat - and my colleagues in biotech like to play this down but I am not at all convinced by their arguments - is that vectors for DNA delivery into humans could go wild and become contagious.

    Of course, I'm opposed to animal organ transplantation for fear of introducing new human pathogens, so maybe I'm just a naysayer.
    • "Good point! This is reason number one NOT to reduce the genetic diversity of the human race. All of these alleles floating around the population - which may become increasingly rare as there is selective pressure against them, and may even cause considerable suffering or death to some of those who carry them - should not be removed from our collective gene pool, at least not without considerable discussion. Why? Because WE MAY NEED THEM. A monoculture (were all organisms have the same genes) is not sustainable in a biological sense."

      Have you read Greg Bear's book, Darwins Radio [gregbear.com]? The whole book is about evolution and a lot of it contemplates these types of circumstances.

    • by efatapo ( 567889 )
      This is a long but ridiculous comment. Have you ever heard of a retrovirus? It's a method for incorporating RNA into the human genome. Oh, imagine that. And it's natural. And it hasn't plagued the human race and killed us all? Or, God forbid, "go wild". This happens to bacteria all the time. This is why bacteria are able to become resistant to antibiotics.

      And could you please elaborate on how animal organ transplants would introduce new human pathogens?
      • Not only have I heard of retroviruses, I have studied them. A retrovirus to be used as a vector for cloning into humans would have to be engineered to avoid tripping any immune system alarms. That's playing with fire.

        HIV is generally agreed to have hopped from a monkey as a result of a bite. An animal organ - particularly when placed in an individual taking immunosuppressent drugs - might pose the same threat.
  • Wired reporter first to be refused any form of medical or life insurance due to his stupidity in paying to find out that he's too risky to insure.
  • I found this particularly interresting and disturbing.


    The fact that Sykes and I are members of the same extended family is just a bizarre coincidence, but it points to applications beyond simple genealogy. "I've been approached by the police to use my surnames data to match up with DNA from an unknown suspect found at a crime scene," says Sykes. Distinctive genetic markers can be found at the roots of many family trees. "This is possible, to narrow down a pool of suspects to a few likely surnames. But it's not nearly ready yet."


    It had never occured to me that Y chromosome passes along from father to son would be almost identical, following surnames as they are passed on as well. It seems obvious, thinking about it however.

    Im not sure I like the idea of possibly being hauled in for questioning because some messed-up branch of my lineage decided to go rob a liquor store to pay off his bookie. Of course, my family blood is too good to worry about such things!

    Scott.
  • Diseases (Score:2, Interesting)

    So if your particulat genome sequence reveals a tendency to contract a particular disease I guess the main thing your going to be worried about is if it curable in the event that you DO actually get it, right (or of any long-tern after effects)? This could be inteesting for some reasons: 1) If you know you have a high chance of catching an uncurable disease perhaps we will end up with hugh scores of people all devoting their lives to curing that disease. Medical teams of potentially diseased doctors looking for the cure to a disease they don't yet have...weird. 2) By sequencing more and more genes a huge amount of data can be gathered revealing those diseases which are becoming more common and greater research put into those areas. Just a few thoughts :-)
  • by grub ( 11606 ) on Thursday October 17, 2002 @12:45PM (#4470383) Journal

    .. The last time I was at my physician he wanted a blood sample, a semen sample, a urine sample and a stool sample.

    So I gave him my underwear.

    [rimshot]
  • I can see it now, insurance companies will have manditory blood tests and then map out your DNA. IF you have a high chance of anything then there will be a premium hike. The world of Gattica becomes a reality, now people like the KKK can use this to further their cause! I see a great rift in society where couples planning to be married will try to get DNA info on their spouse to make sure they're not inferior. I see a new form of elitism coming about where the new aristocracy will be of a genetic elite and those who are inferior will be weeded out through poverty, disease, and depression. They will develop gene therapy that can "Clean" your DNA and make you an elite but it will cost millions, a legacy to leave your children. Then while working yout 80 hours a week popping soma you will go visit quaint villages of non-elites and marvel at their simple ways....

    Behold the Fordian Society of Huxley's "Brave New World" written in the 30s he warned of this day. Now it's finally here...

    It's the end of the world as we know it, but I don't feel fine... not at all...
    • now people like the KKK can use this to further their cause!

      Doubtful. If anything it'll take those folks down a notch. The article touches on the fact that we all have some sort of mixed ancestry; "We are all mutts".

      What happens when the KKK weirdos discover they have (which in all likelyhood they do) have Aferican or *gasp* Jewish ancestry?

      More likely the danger would be in non-minority people discovering faint genetic traces of minority blood lines and abusing that fact to gain special privlidges they otherwise wouldn't be able to receive (or deserve).

      On another note, you have to wonder about what the insurance companies would do about this. On the one hand, it seems likely they would raise premiums on those with genomes with a higher predisposition towards certian deseases. On the other hand, one could assume that in the interests of profits insurance companies would push for cheaper gene thearpy to remove potentially dangerous mutations before they lead to expensive medical positions.

      I could easily see a day where insurance companies encourage (or perhaps even mandate) an analysis of DNA shortly after conception and modify the geneitics of the new life while it's still just a few cells. The logic is simple: Spend $5k to remove defects to save $100k in 40 years.

      It could be very scary, or it could be very benificial. Now is the time to watch the lawmakers very, very carefully.

  • My take on this (Score:4, Insightful)

    by Anixamander ( 448308 ) on Thursday October 17, 2002 @12:47PM (#4470395) Journal
    While screening is an ominous first step, prenatal screening and gene therapy are where this gets really frightening. For starters, as with any cutting edge medical technology, this will be expensive. Therefore, those who would "improve" the dna of their offspring will be the elites. As they branch out from diseases to other areas...intelligence, looks, etc., the line between the rich and the poor will only grow wider. And here in the U.S., minorities represent a greater percentage of the poor than their overall numbers, meaning any growing divide between rich and poor will also widen the racial divide. Unless society comes up with some good answers, the spells big time social problems for the future.
  • About the Author (Score:3, Informative)

    by Nintendork ( 411169 ) on Thursday October 17, 2002 @12:49PM (#4470416) Homepage
    I did a google search on the author's name and found his page. This guy's got quite an impressive list of books and articles. http://literati.net/Duncan/ [literati.net]
  • by grub ( 11606 ) on Thursday October 17, 2002 @12:50PM (#4470418) Journal

    .. back in my granddad's day when you could just discriminate based on skin colour. Now you have to be a damn scientist to hate people.

    Yes, I'm joking!

  • Yet I will be able to glimpse some of the internal programming bequeathed to me by evolution, and that I, in turn, have bequeathed to my children ...
    or not. These types of genetic checks have interesting side-effects, such as finding out that your father is not who you think he was! I read somewhere that this was the case in about 25% of cases. The future will bring us lots of fun!
  • I wont worry too much about it... no CEO wud like to admit that all the employees working under him are smarter than him :-)
    Anyway, there are many companies even now who don't recruit the brightest people. The reason, the brighter they are, the more likely they are to switch jobs. I kid you not but many companies have this policy, or used to do in dotcom era.
    Besides, if you have too many smart people working at the same place, I think that wud create mayhem...just think of the arguments these guys can have...
    So I will say guys, rest assured...we are safe :-)
  • by f97tosc ( 578893 ) on Thursday October 17, 2002 @01:13PM (#4470653)
    With the risk of getting a flamebait mod, perhaps it is worth pointing out that the technology is not all bad.

    So it is creepy to get a genetic test, but also it can be quite useful. If you have predisposition for an illness then you are much better off knowing it in advance so that you can test frequently and adapt your behavior (e.g., diet).

    And of course, if you still don't like it, you don't have to.

    Now somebody will predict that insurance companies will force everyone to do the test, I'll save you the trouble and reply right away. The scenario is unlikely, because there are quite a few legal limitations on what these companies can and cannot ask for - and the majority of registered voters are very sceptical.

    But even if it did happen, would it necessarily be so bad? Widespread testing would make the total, and therefore the average, cost of insurance lower. This is because it is easier and cheaper to treat illnesses at an early stage. Certainly those with certain predispositions would get a higher premium, but would not even that be preferable over paying a standard premium and then getting an illness that could have been averted by frequent tests and say the right diet? One could also think of taxes and subsidies supporting those that got higher premiums. Since the total medical costs would go down, it is at least theoretically possible to come up with a system where everyone is better off.

    Tor
  • From the article:

    The SNPs keep rolling past, revealing more mutations, including a type-2 diabetes susceptibility, which tells me I may want to steer clear of junk food. More bad news: I don't have a SNP called CCR5 that prevents me from acquiring HIV, nor one that seems to shield smokers from lung cancer. "Ja, that's my favorite," says Braun, himself a smoker. "I wonder what Philip Morris would pay for that."

    Hearing about CCR5 was the only thing in this article that blew my socks off. Genetic immunity to HIV? Wow.

    Google hits a lot of things when doing a search for CCR5. The most approachable is here [arizona.edu].


    • What is a CCR5 "defect"?

      A defect normally implies that the system has gone array, however, in some cases defects or simply modifications from the normal genetic code, are helpful. In this case the defective CCR-5 genes contain a 32-base pair (bp) deletion. This deletion causes a shift in the reading frame which results in a severely truncated protein which is unable to reach the cell surface. With this defect AIDS progression is slowed, allowing someone to survive longer. Thus, in this case the defect is actually protective.



      So, it's a buffer overflow exploit, then?
  • Tracing Ancestors (Score:2, Interesting)

    by tomzyk ( 158497 )
    If they can trace most people back to 7 or 8 specific females that lived 20,000 or 45,000 years ago, is it possible to do the same with males? I got the impression from reading the article (4th page) that there is basically NO difference in the Y chromasome between a father and son (except for the given mutation or two that always may occur).
  • Braun, 46, is both jovial and German

    OMG, I didn't think that was possible! What will genetics bring us next?!?
  • by DCram ( 459805 ) on Thursday October 17, 2002 @01:35PM (#4470880)
    my fave quote from the article.
    "One gene seems to shield smokers from lung cancer. 'That's my favorite,' says the doctor, a smoker. 'I wonder what Philip Morris would pay for that.'"
    Ah yes.. now I can blisfully tell myself that yes I must have this gene and therfore my smoking is A.O.K

    Huzzah!
  • ... that your genome is like the climate. And, luckily, there are few climates where humans (perhaps with proper adaptive equipment) cannot live long, happy, and productive lives. What you actually do with that "climate" gives you your own personal weather system that may obviate everything that the climate allows you.

    In short, it's both nature and nurture. Try to be good to yourself...

    Oh yeah, eat your goddam veggies, too, ya little bastards.

  • I think that this might benefit people in that knowing what they are predisposed to might encourage them to live a healthier life, it is a "might be" kind of test. Its like saying that "sometime in the next 55 years, your going to get into a serious car accident" You'll sweat it for a bit, then start driving normaly again. It might happen, it might not, but you'll still drive your huge ass soccer mom SUV to work everyday...

All the evidence concerning the universe has not yet been collected, so there's still hope.

Working...