Forgot your password?
typodupeerror
Science

Burn your genes on CD -- for $500,000 276

An anonymous reader writes "Venter says he plans to offer the service, with the goal of burning individual human's entire DNA sequences onto shiny compact discs. It will cost about $500,000 per person, says the entrepreneurial scientist who helped decode the human genome. "
This discussion has been archived. No new comments can be posted.

Burn your genes on CD -- for $500,000

Comments Filter:
  • by carb ( 611951 ) on Sunday October 06, 2002 @12:07PM (#4397129) Homepage
    If you bring your own disc, that'll only come to $499,990.00
  • what it would sound like. Take the data on the CD, convert it to MP3 or OGG and then have a listen. While most of our "songs" would sound the same, I suppose some filters could be applied to record only the major differences. It might make for some interesting electronica.
    • by agdv ( 457752 )
      I know it's not nearly the same, but have you heard of the Who song Baba O'Riley?


      (Score:1, The Who Reference)

    • Re:I wonder... (Score:3, Interesting)

      by stile ( 54877 )
      This has been done before. Years ago, I don't know where, I heard of someone making "DNA Music". They took A,C,T,G, and mapped them to musical notes: A->A, C->C, T->E, G->G. Fits rather nicely into the key of C major. Then they would just "play" a dna sequence and see what came out... Unfortunately, I have no links to post, I lost wherever I first heard mention of this (discover magazine, maybe?) and haven't found it since. Anyone?
      • Re:I wonder... (Score:2, Informative)

        by jetlag11235 ( 605532 )
        Many links can be found at:
        linkage.rockefeller.edu/wli/dna_corr/music.html

        I can't say that I tried them all ... but one link near the bottom was rather interesting. Thymine in particular is worthy of checking out. AIFF format.
        www.healingmusic.org/SusanA/order.html
      • Re:I wonder... (Score:2, Insightful)

        by Chiasmus_ ( 171285 )
        Years ago, I don't know where, I heard of someone making "DNA Music". They took A,C,T,G, and mapped them to musical notes: A->A, C->C, T->E, G->G. Fits rather nicely into the key of C major

        Dude.. that's an Am7 chord. Your entire song is a "random arpeggio" through a single Am7 chord. Play it really fast and you've got.. an Am7 chord with a lot of vibrato on it.

        I can't say I'm overwhelmingly impressed...
        • Re:I wonder... (Score:3, Interesting)

          by the gnat ( 153162 )
          I dunno. . . put a throbbing techno beat behind it, you might have something. Esepcially since so much of our genomes is actually repeated motifs like SINEs or Alu sequences. Music to clone by. Even better, take some real genes or even just the DNA encoding protein fragments, and see if you get anything interesting. (I think "Leucine Zipper" would be a badass song name.)

          I'm a bioinformaticist- maybe I'll try this if I get bored some evening.
      • Try google...DNA Music [google.com] pulls up some good links...
  • This article has been done before [slashdot.org]!
  • by Moderation abuser ( 184013 ) on Sunday October 06, 2002 @12:10PM (#4397150)
    And it doesn't cost me a penny!

  • by titurel ( 228551 ) <titurel@@@softhome...net> on Sunday October 06, 2002 @12:11PM (#4397159)
    From this first post [slashdot.org]: "Craig Venter, Time Magazine's Person of the Year in 2000 has a new hobby: collecting rich people's DNA. Millionaires are lining up to buy their personal gene maps for the cool price of USD$621,500."
  • Put one in space (Score:2, Insightful)

    by B1ackDragon ( 543470 )
    This is the sort of thing I'd like to see put on a satalite flying through space, for possible future contact with intelligent species. Then they would have a good chance to study other lifeforms, even if we are long gone.
    • by Tablizer ( 95088 ) on Sunday October 06, 2002 @12:46PM (#4397321) Journal
      This is the sort of thing I'd like to see put on a satalite flying through space, for possible future contact with intelligent species. Then they would have a good chance to study other lifeforms, even if we are long gone.

      I think one would need reference info to put the code to use. It is kind of like having the machine code of an app without knowing the machine language.
  • Gives a whole new meaning to a "bug" in your software...
  • by typical geek ( 261980 ) on Sunday October 06, 2002 @12:14PM (#4397173) Homepage
    than trying to find a suitable, willing girl to carry my genes, and probably almost as much fun, too!
  • RIAA (Score:3, Funny)

    by rc27 ( 601744 ) on Sunday October 06, 2002 @12:15PM (#4397179)
    Just more proof that, one day, the RIAA will indeed own all of us.
  • by PaganRitual ( 551879 ) <splaga@NOSPAm.internode.on.net> on Sunday October 06, 2002 @12:22PM (#4397201)
    cool, now i can get the DNA sequence of someone i really dont like, and use it as a coaster for my coffee at work.

    "gee, if im using your genetic sequence to keep my desk clean, chances are i dont really care for your opinion either, huh?"
  • How long till the RIAA finds out how this violates the DMCA?
  • some questions (Score:3, Interesting)

    by john82 ( 68332 ) on Sunday October 06, 2002 @12:26PM (#4397215)
    I don't see what the consumer gets for $500K, but I do see what the vendor gets: your DNA and a big chunk of money.

    1) What keeps them from exploiting your DNA for their profit? Suppose they discover something profoundly unique about your DNA that has significant medical implication. Who has the rights to that information?

    2) How is the information encoded on the CD? Is it proprietary or some kind of de facto standard? (Oh, so you want to use the information? We'll have to read that for you! $100,000 per reading!)

    3) CDs last forever right? Thirty years from now I'll be able to use the information on that CD, right? Didn't think so.
    • Re:some questions (Score:3, Interesting)

      by micromoog ( 206608 )
      1. It's a non-profit project.
      2. It's a non-profit project.
      3. Back it up just like any other worthwhile data.
    • 1> cd /mnt
      1> ls -l
      -rw------- 1 johf wheel 660000000 Sep 20 09:15 dna.txt
      1> more dna.txt
      CGAAGACTCTTTCAGATCGGCTAGATTGATTACATCTCGGG ATCTCTATTGCGCTTAGCCTTAGCGTCTCTCGAGATCGAGATCTCGGCCT ATATTATGACAT
      dna.txt (0%)

      Seriously, the research crowd tend to use simple and open file formats. No need to worry.

      • Re:some questions (Score:3, Interesting)

        by rew ( 6140 )
        CGAAGACTCTTTCAGATCGGCTAGATTGATTACATCTCGG

        Nope. Won't fit.

        The Human gene set holds about 3 billion acid pairs. Thus you'd need a file of about 3 gigabytes to hold it in plain ascii. The file holds only 2 bits per byte, so can trivially be compressed to 600M, but gzip is very likely able to do much better.

        #include

        int main (int argc, char **argv)
        {
        int ch;
        char ACGT[] = "ACGT";

        while ((ch = getchar ()) != EOF) {
        putchar (ACGT[ (ch >> 0) & 0x03] );
        putchar (ACGT[ (ch >> 2) & 0x03] );
        putchar (ACGT[ (ch >> 4) & 0x03] );
        putchar (ACGT[ (ch >> 6) & 0x03] );
        }
        exit (0);
        }

        Regards,

        Roger.

  • by oliphaunt ( 124016 ) on Sunday October 06, 2002 @12:32PM (#4397245) Homepage
    Remember, this is the guy who swapped HIS OWN DNA [hclinfinet.com] with the "random sample" that was supposed to represent all of humanity. Maybe this DNA-on-a-CD scheme is what he wanted to do all along?
  • by Cyno01 ( 573917 )
    Why does it cost half a million dollars to get your genes on a cd when you can get 'em put on a t-shirt [cafeshops.com] for 50 bucks?
    • Your DNA sample will be purified, amplified, expressed and analyzed according to funDNA protocols. A high-quality, clean stretch of quality base pairs will be extracted, combined with one of our designs, and then digitally transferred on to your new t-shirt, lunch box, or coffee mug!

      Because the t-shirt folks aren't doing anywhere close to your entire genome, they state this right on the page you linked to, and a listing of 3 billion base pairs would have to be so small as to be unreadable, no matter HOW large your t-shirt size.

      Wouldn't surprise me at all if 'funDNA protocols' just ignores anything input, and outputs random letters - how is the buyer going to confirm or deny it?
  • by miracle69 ( 34841 ) on Sunday October 06, 2002 @12:35PM (#4397262)
    Chromosome 1:
    atgcgcctagtttatagcgagcgtatgctgatcagtctggtatggt tagt atcgatcgttagctactggtactgtgatgctgtgatgcgtatcgtatctg tgatgcgtatgctgtgatgctgtgggtggtgtggtgattatatatataaa atattttaaaaaaaaaaaaaaaaaaaaaagtgtctgtatgctgtgagctg tgactggttagtggcgtgcgcccccccccccccccccccgtattgggatt atttattatattatatatattatctctatcgcttctgcgtctgctgtgct gctgtgctctctcttcttcttttttttctctctcccgcggcgatgcatgc ggtcttgatcgttaggcttgtatgcgtggtacgtgatgctgtgtctgagt ctggtggatggtctggtctgatgcgttggattgc
  • by DarkHelmet ( 120004 ) <mark@@@seventhcycle...net> on Sunday October 06, 2002 @12:35PM (#4397263) Homepage
    Will a CD like this get me through the express line at an airport, regardless of whether or not I wear a turban.
  • Why a CD? (Score:4, Funny)

    by Cyno01 ( 573917 ) <Cyno01@hotmail.com> on Sunday October 06, 2002 @12:38PM (#4397278) Homepage
    Could i get my genome sequenced onto vinyl?
  • by T-Kir ( 597145 ) on Sunday October 06, 2002 @12:39PM (#4397285) Homepage

    burning individual human's entire DNA sequences onto shiny compact discs

    I can do that for less than $500k:

    Ingredients:

    One CD (make use of an AOL one for a change).

    A skin or blood sample.

    Preperation:

    Put all the ingredients into a casserole dish, preheat oven to gas mark 9. When ready place casserole dish into oven and leave until black acrid smoke comes out of the oven. Et Voila, your DNA 'burned' onto a CD.

    A nice keep sake for years to come! And as Nigella Lawson would say, "Absolutely Scrumptious"!

  • Value (Score:3, Funny)

    by Anonamused Cow-herd ( 614126 ) on Sunday October 06, 2002 @12:42PM (#4397298)
    Sure, it's expensive, but think of the value! I mean, that's just pennies per gene! With all of that information you can.. uhh.... erm..... prove your genetic superiority! I mean, after they sequence your genes and find out that you share 99% of your genes with every other human on the planet, you can use the remaining 1% to find out absolutely nothing that you didn't already know about your phenotypical characteristics! I know -- I'm just getting too excited.

    Now I just have to sell my stock in Venter's enterprise to affod it --- oh wait: I OWE 500 grand on ledger. Silly me!
    Cheers,
  • @fbiTopTen = wget("http://www.fbi.gov/mostwant/topten/fugitives /fugitives.htm");

    foreach $criminal (@fbiTopTen) {
    1. Download $criminal iso image from Kaaza
    2. Clone
    3. Put $criminal in enhanced growth chamber.
    4. Get Lunch
    5. Take $criminal to FBI and collect ransom
    }

    Profit!
  • What is the chance that you'll have an archaic CD-ROM drive in your computer to read it????
  • This looks like one of those old stories about "overcoming his death by sending a message to the future".

    Presently the only good potential customer I could see would be the one that dreams on making a copy of himself when medicine gets to advanced to achieve what can't do today. This thing goes on the same wave as the frozen cadavers, frozen human cells and the frozen human DNA. However we know that all this risk to degrade in time. So the idea of writing up one's DNA would be an intersting solution to these drawbacks. Is it?

    No. Because CD are also not eternal. And besides there is a huge difference between genes and what comes up after. We humans are the less genetic species on Earth, and every detail on character, behaviour and knowledge is mainly a product of our everyday experience. We are formed under the circumstances we grow up, the conditions of our family, society and the world in the whole. Besides every single piece of experience can be very fundamental to our character.

    Let's remeber an old tale that many people used on several SF tales - Adolf Hitler's clones. Would Adolf Hitler revive from his genes? Absolutely not. His copies wouldn't ever seen his strict mother and his father with that very character of an austriac small burocrat. He wouldn't have suffered that poisoning in Ypres battlefield and wouldn't have seen the turmoil of the Russian October Revolution beating on the doors of Germany. He would not be the same racist bastard because his antecessor managed to wipe out a good piece of Jewish population in Germany and this populistic view that "jews are to be blamed for everything" is hardly to be overused today. Who would really be the new Adolf Hitler is hard to predict. However I would believe that his fate would not be shinny. Because he would not have parents, his artificiality would probably hunt him for the rest of his life and society, with its stupidities, faiths and superstitions would always mark him as the "Butcher of the World".

    Well, probably soon we will have "an holographic image of your brain on DVD" together with instructions to reproduce it... But even then I would hardly believe that anyone may get ready for eternity. What would happen if I suddenly travel 1000 ahead from now? Well, let's take someone 1000 before us, and think the SHOCK he would get:

    Boxes showing people or talking.
    Mettalic tubes that spit fire and make huge thunders.
    Big metallic things that move without horses, some EVEN FLY like birds.
    People talking to each other on distance.
    Fire that burns without wood.
    Some strange boxes, made of metal and something like glass, where people write some strange symbols that look like letters and pass huge amounts of time on them. Some of these boxes even play songs or seem to talk. Others show demons, dragons and even trolls.

    In other terms - The Hell...
    • Being frozen for 1000 years and waking up in the year 3000?

      I think I've watched enough Star Trek to get along. I'd probably find some decendant to leach from...

      Then again, I'm just some pizza parlor dude, what do I know?

    • No. Because CD are also not eternal.

      Does anyone know how to do freaken back-ups any more? Has everyone forgotten how to copy CDs?

      Does the word CD suddenly put most people's brain into a mode where they forget the fundamental concepts of digital media?

      Seriously....Whenever "CD" and "back-up" are mentioned in the same aritcal, there's always about 20 posts along the lines of "CDs only last XX years", "But who would still have a CD-ROM in XX years time?", "By that time...".

  • by sjbe ( 173966 )
    I can burn my genes on the stove for free. Heck I can burn my jeans too while I'm at it.
  • IIRC, the accuracy on the current sequencing, while not awful, isn't perfect. Is the company liable for errors in the half-million dollar CD you're buying?
  • Anyone who buys it won't find out they have the Sucker Gene until they get their disc.
  • Yeah? Well I can burn my DNA into a live human being with just a few pelvic thrusts.
  • Why? (Score:4, Funny)

    by Junior J. Junior III ( 192702 ) on Sunday October 06, 2002 @02:19PM (#4397761) Homepage
    Why pay $500,000 for my genetic code on CD when I can just get it off of kazaa or gnutella for the cost of bandwidth? I mean really.
  • Backup (Score:5, Funny)

    by Trickster Coyote ( 34740 ) on Sunday October 06, 2002 @03:16PM (#4398028) Homepage
    It's alway good to have a backup copy of your genes in case you have to reformat / reinstall yourself.

  • Man, when Jr. destroys that CD (as he has many others), the propagation of my DNA will be halted...
  • Before I plop down 500k, does anybody actually know if this sounds good? I mean, I could pay a lot less for bad music.
  • Yeah, "burn your genes"! Now!
  • Hehe (Score:2, Funny)

    by RedWolves2 ( 84305 )
    After you have burned your genes on CD put the CD into the microwave.

    Oh what fun.
  • Anyone serious about preservation of his/her DNA would best save $498,000 and bank their blood or other bodily fluids for 10 or so years. Some companies [cryobank.com] even offer payment plans on that $2000 charge.

    In ten years time the technology to sequence quickly will allow for this operation to be done at 1% of today's cost. (Yes, I will put money [longbets.org] on that prediction.)

    Of course when the time comes, if you really want to keep the sequence a long time, I wouldn't suggest CD-ROM. With a shelf-life [dtic.mil] of 50-200 years under optimal conditions, you'd be better with a book printed on acid-free paper. There you're looking at a shelf life of half a millenium or more under the same conditions.
  • Mad scientists create an amusement park with the theme of cloning a post-neanderthal whose DNA was discovered during the government recall of all "Boy Band" music.

    When the experiment goes awry, a young female tourist saves the day with her knowledge of Unix workstations*.

    *UNIX is a registered trademark of William H. Gates DCXVII
  • WTF sense does this make. You want mt DNA? OK scratch some skin, take some blood.

It is easier to change the specification to fit the program than vice versa.

Working...