Forgot your password?
typodupeerror
Science

Download The Human Genome 159

CMU_Nort writes: "The San Francisco Gate has a story about the completion of the human genome project. Apparently the University of California at Santa Cruz has put the Genome online for downloading here. I don't know about you, but I think this sort of sharing is very cool. We finally have the source for human beings. Now if only they'd GPL it."
This discussion has been archived. No new comments can be posted.

Download the Human Genome

Comments Filter:
  • I hate seeing this kind of knee-jerk reaction in the front page blurbs. These people did not invent the human genome, and thus have no more right to put it under the GPL, or any other license, than Monsanto has to license pre-existing crop strains, yet Monsanto is quite frequently badmouthed for just htis behavior. Any comments?

    -----------------------

  • I hate to point out when someone contradicts themselves but I just have to do it this time. You seemed to miss the whole point of my post.
    There is no such thing as a "phisical gene", the genes only describe how to sintesize a given peptid, and usually changing the gene affects many things. You can change a gene and change skin color and give the subject some tendency to have short fingers, you can change another and make him process less efficiently fat acids, and you can change BOTH and have him grow a new nose in the armpit, and if you change a third one, that one would inhibit the former changes. Not to mention that many genes overlap between them, so you can't change one without changing the other.
    People are different BECAUSE THEIR GENES ARE DIFFERENT. The simple fact that there are in fact genes which determine our physical features (it doesn't matter if they affect other things too) means that a specific sequence of DNA describes a unique individual with their unique physical characteristics.

    The final results of the project which I was talking about (if you actually understood my post) was that if you have a sequence of DNA pairs and put those into a chromosome and put it into an egg cell, you get out a unique individual. For example, here's the beginning of the first sequence on chromosome 21 according to National Institute of Health [nih.gov].

    >gi|8134251|ref|NT_001035|Hs21_443| Homo sapiens 21q sequence /len=219256 GATCTTAGCAGAGTCCTGAAGATGAAGTCCTGGATGAGAGGAAAGCAAGG AAATGGCATC GTGGAAAATATCCTGAAGGATGTTTCGTGGGGGTTGTCCTGGGCAGCACC ATGCTACTGG GAGTGCCACTCACCTGGACAGGTCACCTGGCAGGTGGGCAGCTCTGCACA CCACATACCA CACACACCACATCCCATCCCATCCCATCCCACCCTCATCCCATCCCACCA CTTTTGCTGT
    Is that gene the same as my gene? Genes may be different between people right? You just stated it in your post:
    The map doesn't describe a particular gene set, but rather it describes the locus(positions) of the different genes(there's a difference between the position, which is invariable on the same species, and the genes that occupy it, which can be many on any given species).
    So that big old file I just downloaded with all the base pairs HAS UNIQUE GENES! It may be different than my genes which means... that that file describes someone other than me. Yes.. in fact it describes a single unique individual (hmm, am I repeating myself from my first post... I THINK I AM!)
  • Well, if nothing else, it should drastically increase the amount of paperwork filled out at spermbanks....
  • We've got the source code... all we need is a compiler and an O'Reilly book...

    -Erik
  • Take any two people, regardless of race. Their DNA is 99% similar. For every functional (no errors in chromosmal replication, etc) human our DNA is 99% identical. And of that 1% that differs, only 10% of that (.1% of our entire DNA) are introns, the rest being extrons that are of no known value as the sequences they code for will never be translated to protiens as they are removed in the creation of mRNA.

    Frankly, the point is it doesn't matter the race of the people. Only .1% of our DNA codes for _all_ of the attributes that make us different- eye color, skin color, hair color, etc. And we haven't even yet mapped all of these loci.

  • Some ppl out there are just plain stupid. First off, we don't need to GPL it, it's not owned(except, perhaps, by god). Secondly, we have just mapped what amino acids they genes create, and in some cases, what the results are. Thirdly, it's in binary notation!! There are two possible combinations of neucleotides in DNA. To create one particular shade of eye color for example, it would take the setting of millions of genetic 'bits'. And the genome doesn't have a key, so to say. Basically, we are in the cockpit, know where the controls are, but none of them are labeled. So, to do anything useful with this, in your basement laboratories or whatever, it would take several million years. Have fun.
  • Copyright, yes. Patent, no.

    I'd say if you did the grunt work and figured out the sequence you should be able to charge people for using this information. But if someone else goes ahead and re-does all the work, then you cannot deny them the right to use the results.

    Of course, you could get a patent on some specific methods you developed to perform the sequencing and then other people would have to figure out other methods or pay you royalties for your patents.

  • Who actually owns the gene and information? Could the owner of that actual gene claim a sort of copywrite? Is is possible to copywrite part of your body, albeit very small?
  • God is horrid about commenting code, apparently ;-)

    (So spaketh the agnostic.)

    ----
  • IANAMB (Molecular Biologist) but I believe what they did here was figure out what the individual pieces of the human genome were.

    (For lack of the ability to come up with a better analogy) It's like if all cities had the same map, then they discovered the road map of cities. It's what is at each address in the city that makes the cities unique and gives them character. They are just telling you where the houses go, what makes people different is what the houses actually are.
  • the 24 chromosomes has been online'd by project gutenberg for a while now
  • You better make sure your wife has a chance to read the license, because she will...er...distribute your code. (Jews may choose to put the license directly to the Ketuba).

    OTOH your kids are safe, because they are not likely to distribute the "cyb" parts of them, only "org" parts. It's ok to combine non-GPLed stuff with GPL-ed stuff as long as you don't distribute the combination.

    But wait...When you...erm...ugh...entertained yourself with your...oh...palm, didn't you actually release your genome to public domain?

  • Dude, that was hilarious. Thanks for the good laugh.
  • My understanding is that it's only half that. There are two versions, one with larger files, and one with smaller files in more directories.

    --
    Marc A. Lepage (aka SEGV)
  • The Grammar Jew wants you to know that the proper word is copyright, meaning "right to copy". The word "copywrite" does not appear in major dictionaries, but one may argue that it could mean "[to perform] a copywriter's job" or something similar. A copywriter is a writer of advertising or publicity copy.
  • If He had, it expired some 5740 years ago.
  • The human genome is only 99% complete. The last 1% will apparently take years. This is due to the method used to discover the genome. In addition, only the composition is known, the function of the genes is far from known for many (I think most) genes.

    Still, the sharing is cool.

    Lee.

    PS I posted this before but with the cookies turned off I came off as a coward... Oh well, that's usually true..

  • Of course, people actually downloading the whole human genome probable wouldn't worry about this, but couldn't they use a better compression format than .zip? I bet using bzip2 or rar would shave a couple of hundred MBs off of that 753MB file. Also, the differences in compression techniques would be interesting to see on a large group of files mainly consisting of G, A, C, and T.

    -- demiurge
    You find a file that appears important and obliterate it from memory!!!
    Score one for the downtrodden hacker!
  • They would have to add a new flag and invokacion command like g++ is for using gcc for c++. I guess that would be called using the DNA libraries to link it.

    That same invocation (hey, did I spell it right this time?) could be used to compile and link genomes for other organisms like the fruit fly, or anything else we may have mapped, from sources.

    Now we just need to right the libraries. Shhh, don't tell anyone that's the hard part.

    Ever get the impression that your life would make a good sitcom?
    Ever follow this to its logical conclusion: that your life is a sitcom?
  • If anyone tried to licence this, I'd hit 'em with a prior-art based lawsuit, based around the fact that I was using the code long before they licenced it. Of course, people born after it was licenced wouldn't have this option. Of course, I could always just make them pay me royalties...
  • by Uruk ( 4907 ) on Friday July 07, 2000 @07:55PM (#949662)
    Keep in mind that there is only a 5% genetic variance between monkeys and humans.

    Which means, that unless they checked and double checked this data, if you actually try to compile it into a human, you may end up with a 5-nosed purple haired, blind and deaf armadillo-platypus mix with ESP and a penchant for buggery. :)

    They really do need to GPL this, if for no other reason than for the NO WARRANTY clause.

  • for people in australia wanting to have a look
    at this - i've mirrored a copy for download at

    ftp://mirror.aarnet.edu.au/pub/genome/15jun2000/
    http://mirror.aarnet.edu.au/pub/genome/15jun2000 /

    -jason
  • Does anyone know a program that can turn this information into something viewable in linux or, windows even? I wanna see the purdy helix :-P
  • Actually we can 'compile' the code because we know all the enymnes (polymerases) etc that turn the dna into rna then into proteins, and we know how they work.

    So the higher level building block would be the resultant amino acid sequence... Then the functional protein..

    'Random' is not a good word to use when talking about genetic material. What influences that decide what information carries on through the generations isn't a result of randomness.. Although base-pair mutations do happen in a generally 'random' way. If a protein is rendered non-functional due to a mutation the other copy of the gene is still functional. Hence non-functional or seeming detrimental genes are carried through time until either they turn out to be an advantage at some point, or a whole new trait emerges. If you study genetics for some time you begin to realize that 'mistakes' or abberations are the pool by which functional innovations occur. Judging genetic fitness on a basically arbitrary basis i.e. anyone saying one trait is the prefered or 'correct' trait are demonstating their misunderstanding how evolution works. There are numerous examples of this. There's the classic sickle-cell enemia example, and those people that carry a defect in a specific protien so the hiv is unable to attach to and infect their cells.. hence, they are immune.

    Due to the billions of individuals.. Aside from other factors, randomness occurs within the context of the individual but not within the context of the popluation. Populations and species evolve or remain at a genetic equilibium for very systematic reasons.
  • We finally have the source for human beings. Now if only they'd GPL it.

    Yeah, too bad they didn't comment it.
  • Where can I get the diffs and patches to assemble my own Cindy Crawford??? If this isn't proof that open source is the best way to date/recreate!
  • If ya boot up that woman, by golly you're gonna marry her.
  • The DNA of a human being is the binary. Source code is normally commented, and that's what they're working out. They've sequenced the genome (== dumped the binary); now they're mapping it (== running a debugger, disassembling, and commenting the source).
  • There was one poet who patented herself ( I think It was a patent. Could have been a copyright.)

    She claimed that she was a unique individual who had spent considerable time and effort 'inventing' herself.
  • Not strictly modifies, but creates a derived work, which is the same as modification as far as GPL is concerned.
  • Hey, this ain't the source, it's the assembly!!! Anybody got the source out there? Preferably with comments?
  • As we now have Lars from Metallica's DNA (as well as everyone else) we now have prior art and thus the metallica copyright is invalid!!!!!!1
  • This is a really weird idea, but what if the genome was translated into binary and compiled? There are two base pairs, (AT and GC, for those who didn't pay attention in biology), and binary has 0s and 1s.

    If the AT pairs were translated into 1s and the GCs into 0s, and vice versa, we might get some really interesting stuff, or a blue screen (hmm...mayble linux would be better for compiling).

    Of course, this same philosophy can be translated into organic computing in the same manner, and genetic code can store data.

    If somebody wins a nobel prize for this, remember it was my idea!
  • Would that mean if I decide to have a kid (thereby utlizing and modifying my genes, and agreeing to the GPL) but then later give the kid up for adoption (redistributing the binary) I'd have to include a full copy of the source code? (Fully sequenced genome for the kid)

    That could get expensive! :)
  • This next small step is very exciting, and we *need* all you Linux hackers out there to get involved and write more code to do cool things for this project. There are not nearly enough young programmers working on this project, get out there, learn a little about DNA and start HACKING! We just had a young Linux hacker work for us at the BC Genome Sequence Centre [bcgsc.bc.ca], and he took a program (fpc) [advogato.com] that used to take 1.5 WEEKS to run on a hot Sun box, and it now runs in about 17 hours on our distributed Linux cluster (30 processors)!!! FPC has been around for years, and this speedup has *revolutionized* map building. There's LOTS more opportunties, so get out there and get CODING [sness.net]

    send resumes! :) (sness@sness.net)

  • look that genome it's mine, look i already have a copy on hand. Now that it is mine i would like a fee paid to me every time you use it.
  • Heh.. but that's an important question none the less.

    I would like to ask /. the following:

    What research or theory suggests that intelligence is encoded in DNA?

    Ok ok ok totally out of context (maybe) but as far as I understand this is assumed, just because there just isn't anything else to account for.

    It seems like scientists are trying to decode *everything* from DNA, without thinking of the consequences:

    Let's say that you and me are 99.999% genetically indentical (it's maybe even more than that). Could *really* that least digit make us so totally different ??

    Does not the fact that humans are so totally influenced by their environment point to that DNA really is not that much acountable for the more "deep" things like thoughts, consciousness and the like.

  • Disclaimer: I don't know genetics, and never took biology
    It appears to be a matter of taking DNA strands, breaking them up into smaller pieces, getting the individual genomes and then mapping everything back into a picture of the original. I didn't realize it until reading on the site that it's very possible to have read the codes backwards, which makes for an interesting twist on things(No pun intended).
    The Human Genome Sequencing Progress [nih.gov] page shows that they have 21.1% complete data. I assume this means they are relatively certain everything fit right. (Imagine a puzzle with many pieces that fit in more than one place)
    I don't know how long until they get it all, but it seems to be paying off already. Of course, once done, they will have a map for one person, not everyone. (As I understand it)
    --Mike--
  • by Jonathan ( 5011 ) on Friday July 07, 2000 @07:56PM (#949680) Homepage
    Although the article doesn't really explain it, what this programmer did was write a contig assembly program -- a program that tries to find the most likely ordering of the fragments in the raw sequence data.

    While it is very impressive that a programmer was able to write a contig assembly program in four weeks, and that it only took three days to assemble the entire genome, I really doubt that this particular assembly of the genome is going to be definitive. People like Gene Meyers and Phil Green have devoted years to developing such programs, and I think the results of their programs, although probably taking more than three days to run, are likely to yield more accurate results.
  • So when will gcc be able to compile the source into a working AI?

    The real question is, when will we invent a brand of coffee which keeps me from making crappy spelling errors in my slashdot posts late at night?
    They would have to add a new flag and invokacion
    Now we just need to right the libraries.

    That's not counting the ones I caught before I hit submit.

    Ever get the impression that your life would make a good sitcom?
    Ever follow this to its logical conclusion: that your life is a sitcom?
  • Somewhere I heard that race accounts for less than half of the the genetic difference between two humans, it's only a few genes that make racial differences.
  • I think some of us finally after laughing loudly at first, then more and more quietly, at joke after stupider joke, are realizing that maybe Slashdot should change. Maybe the Linux community as a whole should change (Linux.com has up stupid polls [linux.com] too, missing a chance at getting actual valuable feedback from the community). Maybe I'm wrong, maybe it's destined to stay the way it is. But if it is to change, that change will be to grow up. Then again.. serious news at Slashdot? Maturity from editors? (besides Jamie, she's the mature one) Maybe not in my lifetime.
  • DNA that is transcribed into RNA and hence into proteins is read off of only one strand. There are recognition sequences to determine the beginning and end points of transcription. Also DNA has a 'direction' 5'->3' so you can tell which direction is which. I'm sure whatever ind of software the transcription guys use recoginzes this.

    As for second point our DNA is for the most part almost identical. We need to have 99.9% of the same parts in order to run properly, i.e. everyone's gene sequence for hemoglobin is the same. So there is almost no variation in most of the genes in which mutations would be lethal or at least very bad. The genes that do allow variation.. i.e. eye color, are of a very small percentage and variation is allowed within those genes..
  • Just imagine what microsoft could have instead of that annoying little paper clip!
    --
    Glenn

    HEALTH WARNING:
  • It is not only: take two people. We share 99% of our genome with apes, about 96 or so with other mammals. So why bother about races... And wasn't it only 85% of the genome they mapped ?
  • We are going to take your advice and experiment with the best compression methods. We figured the zip format was available to the largest pool of users, but given we have the disk space, we should try to reduce the download size do to the massive interest. Thanks.

  • I don't agree with the statement that "we now have the source code for humans". What we seem to have, is a core dump of the "binary", without a dissassembler or any concrete idea of what the higher-level building blocks are. Furthermore, this "binary" has not been produced by a heavenly programmer. Instead, it is the result of a "Genetic Algorithm". If you have ever looked at the results of a genetic algorithm, you would see that they lack any "logical" structure. It is very difficult to see what the code is actually doing, since it hasn't been produced by a logical process, but rather an almost random process over millions of years.

  • We are working on a writeup page about the technology used for this. It was indeed 100 Linux machines and yesterday the machines running as the web servers pushed out .5 TB of data.
  • I am surprised I don't see this mentioned anywhere, but the cluster of machines at UCSC that helped crunch the genome were all running Linux.

    It was quite an impressive site when they were all sitting in a lab room with huge window. :-)
  • Um...no.

    If somebody will modify the genome to create a superhuman and then release that superhuman, without also releasing the modifications in source code form, that would violate GPL. (As if anyone will care.)

  • <just a thought>
    GPL defines "the source code" as "the preferred form for making modifications". I don't know about you guys, but I prefer to modify my genome...er...differently.

    No, certainly The Sequence (how's that for a movie title?) is not "the source code" for humans.
    </just a thought>

  • Why of course they released it so we can generate pads [eleves.ens.fr] and start off with a wonderfuly large (few hundred megs with the right algs) paddbase. So get crack'n!
  • I thought that anything like that was pretty much GPLed by God anyway? Or don't the bible and ten commandments count?

    ... maybe I'm getting them confused with the manual or the warranty.

  • It was a joke!! "Now if only they'd GPL it" was a poke at the zealots on this site who parrot their little catch phrase without really understanding it. UCSC (go Slugs!!!) is doing us all a great service by actually publishing this stuff.

    PS. I go to UCSC if you hadn't noticed.
  • I thought it was a joke, personally.

    I guess I was in the wrong since both Hrunting and, ATM, +3 moderators agree.

    Hmm.
  • Does that mean that if you make kids with this thing, you hace to have them cary their source with them?
  • Funny, we also share 99% of our genes with pygmy chimps. Maybe ut's not really the _human_ genome.
  • by Seumas ( 6865 )
    Even compressed, it's well over 700MB's.

    But for this blasted dial-up, I would generate my legion of SlashMonkeys!

    Maybe I'll just wait until "The Human Genome" comes out on audio-tape so I can hear it recited by James Earl Jones.
    ---
    seumas.com

  • Bruce is joking (he's joking, right?), but the question remains: can people really patent and copyright this kind of stuff (genes, and the like)? I can see how it is valuable intellectual property, so someone is bound to try it, but on the other hand, you don't invent anything, you just discover it.


    ========
    Stephen C. VanDahm
  • with 99% the same genes,
    we can start mating with monkeys.
  • Did you get that joke?
    was it funny?
    mod it up then.
  • If it were students pushing out 5TB worth of 700meg files they would be accused of pirating VCDs...

    Can we now claim that we are just trading our genome with our friends?

    :-)
  • by Anonymous Coward
    ...go through one article where the god damn GPL ISN'T mentioned???
  • Okay, so we missed out by 1.6% from being a monkey. As I understand it (I'm definately not a science/biology fellow) we're also something like 95% water. Clouds are 100% water. Did we miss out by 5% from being a cloud?
  • can people really patent and copyright this kind of stuff (genes, and the like)?

    Yep, they can (and do). The logic being that it costs a lot of money to do the research, and that without patent protection, they wouldn't be able to recoup that investment. This is, in fact, pretty much what patent law was designed for in the first place -- to stimulate progress by providing financial incentives to do so. The only problem with this theory is that they're patenting things that they didn't invent. And in the case of the human genome, the stimulating progress argument doesn't hold. The HGP was doing the work already. IMHO, the human genome is too important to allow any company to control.

  • gattacagattacagattacagattacagattacagattacagattaca gattacagattacagattacagattacacatgagacctgatggttttata aggggctcttccccctttgctcagcacttctccttcttgccaccgtgca aagaaggtgctttgcttcccttcaccttccgccatgattgtaagttcctg aggcctccctagccaggttgaactgtgagtcaattaaaactctttccttt ataaattactcagtctcaggcgattacagattacagattacagattacag ttccgccatgattgtaagttcctgaggcctccctagccaggttgaactg agttctctatggcagtatgaaaacgtactaatacaaataacaaaggtttt atgtttcctcccaaattagtgtctagagtcaacgttagctcctagggtca agctattatacaggattagaggcatttaggagattacaacttttccctgg tttttcaaagattagtcacatgttcacttggctgaatacacaaggtagaa tggacaggacttgaggcaaataaccttgtggttaagagtactcaggttca gattacagattacagattacagattacagattacagattacagattaca

  • thoughts, consiousness, amd the like are just concepts we humans made up. think about that for a while and your mind will dazzle.

    nature vs. nurture is of course a very complicated thing. but i don't think it helps simplifying the argument by saying "well our genes are the same, why aren't we the same". the human genome is just a blueprint. imagine a large building, being built from a blueprint. imagine that happening again. can you honestly say that those two buildings will be exactly the same? no, therefore an identical twin will also not be exactly the same. but they do look alot alike.

    do they think alike. most probably not completely, since they're in the same enviroment, and have to somehow find their own niche in that enviroment.

    instead, try not to look at differences, but at similarities. although humans seem to behave in a very different way, their individuality arises from minor differences. in essence they are very similar.

    so:
    1.identical blueprints will not result in the same end product in a natural enviroment
    2. humans are very much the same, and not so different as you might think!

    ta,
    meneer de koekepeer
  • Go Here [ucsc.edu] and search for "GATTACA".
  • i've heard of exons, but extrons are a totally new concept to me. tell me what are these special, human specific dna-elements called extrons. apparently an integral part of those dna element one refers to as genes.........

    excuse my cynical comment, moderate me to -100 if you wish

    meneer de koekepeer
  • Oh, you were attempting a joke? If not, you better explain what god (no caps) has to do with this. In my , not so humble, opinion this is off-topic.
  • From what I remember, they can identify bits in the DNA, by sampling identical twins/triplets etc. because they should be quite similiar, they can then compare the DNA and see which bits make us unique.

    I am pretty sure that they use this technique as the basis of finding genetic disorders and hereditary disorders etc.


    -
  • >Preferably with comments?

    Actually, I very briefly spoke to a guy, who presented his work on annotating the genome in the EnsEMBL project after his presentation. The software they have written to control the tremendous logistics involved in "commenting" the genome is released under a BSD-style license (disclaimer: as I recall).

    When I asked him why it wasn't released under the (L)GPL license, he said that the lawyers had declared the (L)GPL a "legal nightmare".

    This put aside (I don't remember the exact arguments), I think the fact that these people release their software using the open-source principle should be acnowledged, therefore I thought I'd just mention it here on /.
    meneer de koepeer
  • i'm not sure, but i don't think that all the software you just mentioned is gpl-ed (as if it matters)
    regards,
    meneer de koekepeer
  • We're not dealing with software here

    The hell we're not. DNA is software. It's a coding scheme for assembling amino acids into a specific sequence to produce proteins. Each amino acid is coded for by a specific three-unit sequence of DNA bases (with some coding redundancy). DNA (more precisely, the information coded by that DNA. The physical DNA is a substrate for the information in exactly the same way that the pits on a CD are a substrate) is a software program that when loaded on to the proper hardware (a cell) will cause that hardware to perform particular functions.

    DNA implements a coding scheme just like ASCII or Unicode. It's not an "analogy", it's a fact.

    My greatest fear is simply that the genome will be modified at all.

    So we should ban evolution altogether, then?
    --
    WordSocket Voice BBS Software

  • OK, I have downloaded the genome, indexed it and have it available for my users.

    The latest full release of EMBL (63) weighed in at about 4.7 Gb compressed. This took me about 30 hours to download.

    GPL'd tools are available. Checkout EMBOSS [sanger.ac.uk] for a start, BioPerl, BioJava, bioPython, and BioXML, all linking in with a common biocorba interfaces, and many more besides.

    I run my bioinformatics service with a minimum of commercial software (only one commercial package which I am soon replacing with EMBOSS, and several non-open packages. The majority are open to some degree.

    Needless to say it is based on Unix systems (IRIX/Linux in my case).

    ..d

  • It is commented. It is just that we can't read the comments. What do you think all this 'junk' DNA does between the genes?

    ..d

  • My greatest fear is that the genome will be modified to create more zealots for /.. Imagine a race of superhumans capable of posting "Foo should be GPLd" messages as fast as today's trained apes are posting "First Post" messages. There'll be license jokes, insensitive "treat AOL users like dirt" jokes, Microsoft jokes, bad trolls moderated up as funny, good trolls moderated down as flamebait, and flamebait moderated up as insightful. It'll be July 2000 all over again! We must take action to prevent this!
  • by Animats ( 122034 ) on Friday July 07, 2000 @09:02PM (#949724) Homepage
    ow much data is in a genome...
    Human DNA is roughly a gigabyte. It's interesting that the download, compressed, is also about a gigabyte.

    Now we have the object code. Much of the rest of this century will be spent trying to disassemble and comment it.

  • For most of us it's not a lot of use, I'd agree. Howver, if you're a specialist researcher in numerous biological, medical fields (and possibly anthropology, archeology, geneology and others as well) this stuff is a potential goldmine.

    Provided you have the software to mine it of course.

    Putting the genome in the public domain is a great start but to make it truly accesable requires freely-availible (i.e. open source / GNU / FSF) tools with which to explore it. Otherwise, as you observed, it's pretty difficult to follow.

    My guess is that if those tools appear then one day not too far away kids in highschool will do lab exercises in biology class that involve cloning genes and so forth(* [slashdot.org]). That may seem far-fetched but I suspect that we're witnessing a nascient technological revolution at about the stage that the current "computer revolution" was in when a bunch of geeks were doing apparently pointless things with the original Altair.

    * If OS/GNU tools don't turn up most schools aren't going to be able to afford the tools - so no labwork.

  • Under the Universal Copyright Convention (Berne), a copyright notice is not required. As most nations are members of either or both the UCC and WTO (which requires adherence to the UCC), there are only a handful of nations on Earth where a copyright notice can possibly be required, and in few of those is there any actual recognition of copyrights at all.

    Steven E. Ehrbar
  • Of course, once done, they will have a map for one person, not everyone.

    This is not correct. The privately funded Celera used DNA from several individual sources. Every normal human has the same set of genes (genes are fragments of DNA that are translated into functional proteins). Variations in this are due to mutation and can cause inherited or spontaneous disorders such as cystic fibrosis or marfans. Where we are different is in what's between the genes (composed of random junk and tandem repeats). When forensic scientists use DNA evidence to connect a suspect to a crime, they are not actually comparing the DNA base pair-for-base pair (that is to say, they're not looking at the A's, the T's, the C's, and the G's). Rather, they compare the lengths of fragmented DNA from two sources fragmented by the same enzyme(s). I digress. Basically, since the genes, though they make up a relatively small portion of the whole length of a strand of DNA, are what give us our fundamental human characteristics, and they are basically the same for everyone, the efforts of the Genome projects will produce a one size fits all product.

  • There is no http://genome.ucsc.edu/robots.txt [ucsc.edu]. And we are talking of an enormous database.

    You'd better keep your robots off the site.
    __
  • Truly impressive when one realises that the compressed files alone weigh-in at just a bit over 1500 MBs. Has anyone actually downloaded and unzipped the files? I'm not looking for laughs or a troll here, but I'm honestly curious just how much data is in a genome... a viable storage medium, perhaps? I'm serious.

    ----
  • Yeah, that would give a whole new meaning to the expression "GPL virus". I can already picture it:
    I create virus, GPL it's DNA, and then release it. You get the virus, get contaminated, and now you are required to release your DNA specs for everyone to see! Yeah! Go, GPL, go!
  • An oft-overlooked characteristic of the U.S. patent office is that they gladly accept models to support a patent claim. So, I suggest that Slashdot readers fill out the form and send in a test-tube to support their claim. What to put in the tube is left as an exercise for the reader :-)

    Bruce

  • Since everyone's DNA is different, how do we determine which part is what makes us unique, which part is changable (to a certain extent to make us humans "compatible") and which part is disposable DNA? Was the genome a replica of a caucasian, asian, black, or a bit of each?

    Go get your free Palm V (25 referrals needed only!)

  • So how long until someone writes mod_human for apache?

    Although the benefits of embedding a human in your web server are dubious.

  • race accounts for less than half of the the genetic difference

    Isn't that what you'd expect? In fact, I'd be rather surprised if it was anywhere close to half.

    Not only can the races interbreed with complete success, there are morons and geniuses, weaklings and strong men, over roughly the same large spread in each race. To me these facts alone suggest that there should be far greater diversity within races than between them.

    However, I don't take this to mean that racial differences are necessarily insignificant or uninteresting, though one should naturally expect all but the most blatantly obvious to be lost in the variety of individuals.

    But isn't the genome the complete set of genes for the species? Not the genes of one man, but the total genetic catalog of all mankind? If so, the question "Which man?" (to which you replied) is nonsensical.
  • I'm not looking to troll here, but, honestly, what possible reason, (besides being able to bring a chick over to your house and say 'hey baby, wanna see my source code?') would anybody have to download 1500 megs? I dug around the site, and I found a sample of what is contained in those mammoth files; you can check out what's contained within the zips here [ucsc.edu] .

    Again, I'm not looking to troll here -- I'm just curious, that's all. =)


  • by Jonathan ( 5011 ) on Friday July 07, 2000 @08:55PM (#949773) Homepage
    Actually, DNA compression is a topic of interest, not only from the standpoint of saving disk space, but also for analyzing the sequence -- areas that compress differently may have different functional roles. You can read a paper on the subject by some people I know here [uwaterloo.ca]
  • If I GPL my genes, then later, my children want to become cyborgs, would they be violating the license if they were to use implants that weren't GPL'd?

    Would I be better off releasing my genes under the LGPL?
  • There are a TON of freely available bioinformatics type programs available, a good start is to browse Biocat [ebi.ac.uk]. Of course to get any use out of these programs you should have some knowledge of biology & computational biology. Traditionally academic software is very open, though not GPL (I'm beginning to hate all you GPL-wanting whining fuckers (this is not necessarily directed to the poster I am replying to)). An unfortunate trend as of late is servers which provide an application but no binaries to run locally, and no code. Not very scientific if you ask me. Also not helped by the GPL.

    one day not too far away kids in highschool will do lab exercises in biology class that involve cloning genes and so forth

    In high school I took Advanced Placement Biology (suppose to be equiv to an intro college course) and one of the labs was to introduce a plasmid into E. Coli so that it became immune to ampicyllin, an anti-biotic. Genetic experiments are definitely possible at the high school level, it's just a matter of getting the expensive machines and specialized knowledge. Maybe a schoold district could put its money into a couple PCR machines and a knowledgable lab tech?

  • by Hrunting ( 2191 ) on Friday July 07, 2000 @07:34PM (#949778) Homepage
    Now if only they'd GPL it.

    Geezus, why does everything have to be related to open-source software? We're not dealing with software here, folks, no matter how many analogies you want to make.

    Guess what, the human genome is better than GPL'd. It's completely free. If you alter it, you have a copy of the new code right in the genes. We did majority of the work on decoding the genome in the last 2 years. Decoding is practically trivial now, and the finished product carries with it the code that made it.

    Everything is not software, and not everything should live by the rules of software. I personally would love to stop hearing talk about licenses with respect to the human genome and start hearing talk about the responsible use of the code. My greatest fear isn't that someone will modify the genome to create a superhuman and then not tell anyone what they did. My greatest fear is simply that the genome will be modified at all.

    There's a fine line between advocacy and zealotry
  • Can you imagine if M$ tryed to make a DNA replicator. Can you say blue chromosome of death
  • Are they accepting diffs?
  • I'm donwloading sequences (human included) since 1994 from NCBI web site (http://www.ncbi.nlm.nih.gov/).
    I'm working on sequence analysis to make philogenetic trees in Quilmes University (Argentina).

  • Actually, I hear some biotech companies have acquired the rights to some of the "more interesting" genetic material in places like S. America in exchange for a new family cow or somesuch. I can't recall where I read this, but I ask that you believe me anyway.
  • but I prefer to modify my genome...er...differently.

    Sunbathing?
  • And that modifies your genome?

    Holy Shit! No wonder my grades have been dropping! I need to start dating smarter girls!

    ...and girls with smaller breasts.
  • Quick download the human genome and spread it around the internet before the RIAA and MPAA try to stop links to it. Humans duplicate copyrighted material. These agencies do not want the information required to build a human to be available.

    We must stop them from eliminating humans in the name of greed.

    There is also a rumour that they are attempting to patent sex.

Last yeer I kudn't spel Engineer. Now I are won.

Working...