Forgot your password?
typodupeerror
Science

Human Genome Project Believed Complete 187

wecoyote writes ABC News has an article on the completion of the Human Genome Project. Apparently, there is supposed to be a presidential announcement this morning regarding the accomplishment. "
This discussion has been archived. No new comments can be posted.

Human Genome Project Believed Complete

Comments Filter:
  • The article fails to mention that President Clinton has been one of the most prolific supporters of the Human Genome Project. The "dress stains" alone probably cut 2-3 months off of the total time to completion, and hence it is only fitting that he be allowed to make the announcement.

    ---
  • Let the patent wars begin!
  • Does that mean we can get rid of the "first post" gene?
  • I wonder if the genome team uses gnome because they're spelled so similarly...!

    Mike Roberto (roberto@soul.apk.net [mailto]) -GAIM: MicroBerto
  • So does this mean that now they can isolate the gene that is responible for us being human and change it so we now are all pegniuns?

    Or maybe it would be better if I stuck to eating my pegniun mints, and sleeping with my stuffed tux at night...

  • I seem to remember this project having a projected completion date of 2001 or later. Does anyone know how the projections changed as computing power and the analysis techniques got better?
  • http://news.bbc. co.uk/hi/english/sci/tech/newsid_805000/805803.stm [bbc.co.uk]

    This is widely being reported in the UK lunchtime news bulletins right now. I note that the Wellcome Trust and the Human Genome Project of which they are a member hail this breakthrough as a "great gift to humanity" and that Celera, the US corporation providing alternative research, wants to patent it all.

  • I think all human beings should be thankful for the Human Genome Project, for if it has truly won the race to map the human genome then they may well have saved the human race trillions of dollars in medicine's that come as a result of gene therapy. They have also guaranteed the free use of the genome for science.
  • We can rebuild Linus, we have the technology. We can change him, make him better. Give him yellow feet, and a prehensile tail [to write code faster]. Super sonic hearing, to stay to steps ahead of the evil redmond empire. Better sight to see the transmeta code in a new light. And strength of titanium, because that would be cool.
  • Isn't that supposed to be the "Human Gnome Project"?

    I'm sorry. I just couldn't resist.

    kwsNI

  • The people of Atlantis already did this. Where did you think al the penguins came from? Duh!
  • A geneticly engineered five assed Bill Gates?
    Just think of all the crap that would come from Micro$oft then....
  • by Anonymous Coward on Monday June 26, 2000 @03:28AM (#976695)
    Human Genome Project completed! +1 talent at each base. The governor of "washington, dc" is asking you to initiate a new Secret Project, The Virtual World!

    Allow the governor to initiate a secret project
    Disallow the project, and tell the governor to interest himself in "sensible things"
    Cancel the project

    OK

  • Hardly hi-tech but this comes direct from BBC News :
    "The rough draft has been completed several years ahead of schedule thanks to the introduction of new robotic technology and the competition Celera gave the HGP when it started work in 1998."

  • so when do i get my third arm? oh the things i could do with that arm. imagine the stability improvements when standing on one's head! the benefits for society are limitless.

    --
  • So the HGP and Celera have managed to sequence the geonome of a single person. This doesn't really address the fact that there are variations on genetic sequences even those that code for important proteins. Some of these variations cause problems but others don't. Although HGP is attempting to sequence the geonome's of 4 different people in other to get this variation, this doesn't really capture the distributions across different ethnic groups. Getting that is problem that is even larger than sequencing a few geonomes.

    Another problem I see is that even if we are able to sequence the genetic code for all the proteins, what are we going to do with them. Identifying genetic diseases before they occur is all well and good but is it really that valuable if all we can tell people right now is that twenty years down the line you're going to get Hunington's disease or someother incurable ailment and die?

    The outlook for coming up with effective genetic therapies is pretty bleak. We haven't really been able to treat even the diseases that are purely genetic and are caused by a well defined mutation. With this sort of track record how are we going to do against diseases that are caused by multiple mutations or where different individuals with the disease have different mutations? And this isn't even considering diseases that are caused by interactions between interactions between the gene and environment/history of the individual or disease caused non-genetic inheritance.

    It seems like alot of people see genetics as a panacea for all human ills. However this overlooks the fact that the environment is just as important as genetics. In some respects, the attention that whole gene therapy is getting resembles the hype that surrounded radiation in the early 20th century when radiation was going to cure anything and everything.
  • Civilization? I remember it rezzed in... it was one of the "wonders of the world"...

    I can't remember what effect it had on the game though...
  • Yeah, but I'm waiting for 1.2, which is supposed to fix that whole 3rd arm bug, as well as allow for customization of several body parts and mental abilities.
  • And it's rumored that 1.2 will be released under an open-source license!!!
  • Wow; Does this mean i can order my extra leg now?
  • This doesn't really address the fact that there are variations on genetic sequences

    This is also under investigation by both the HGP and Celera. The number identified is measured in tens of thousands, and will keep increasing rapidly for a good while.

    The outlook for coming up with effective genetic therapies is pretty bleak. We haven't really been able to treat even the diseases that are purely genetic and are caused by a well defined mutation.

    Well, that's not really true. X-linked SCID is one of the frontrunners in this area, and it's just reaching actual use in actual patient - only one or two so far, I believe, but the experiment seems to be going as well as could be hoped for. These things are obviously going to take a while to reach the real world, but just because they're not in use yet doesn't mean that they're not on their way.

  • I'm a little worried about some of the outcomes of this. What if before you were born a doctor was able to tell your parents that you would be blond, 6'2, and suffer from a number of things that they have defined as defects. Would your parents want a child that has bad eye sight? Would they want to deal with your addictive personality? What if they had the ability to tweak your code before you were born and decide what to keep and what to bring back to the norm that they have decided is right. Don't get me wrong this is a huge achievement but the real question is what to do with this information now that it is available.
  • by stx23 ( 14942 ) on Monday June 26, 2000 @03:38AM (#976705) Homepage Journal
    Given Celera's previous glitch [wired.com], will the two Genome maps be combined and compared to give a better idea of overall accuracy, or will one be pandering to the private Sector, the other to the public sector?
  • I have never understood what it means to 'map the genome.' Have they gotten a complete GATC sequencing for one person's DNA? If so, how will this help with all the coming miracle cures the media always mentions. It would make sense to me if we had gotten a GATC sequencing for a large statistical sampling of people so we correlate epidemiological data with genetic data; but this doesn't sound like what the media is always talking about. So what's really up?
  • While I'm all for the advancement of science and improving the lot of humanity, I really think that the widespread use of genetic engineering can only turn out to be a mistake of the worst kind.

    Unfortuately, given today's socioeconiomic structure in which corporations have, thanks to America's love-affair with hardcore capitalism, the power to do practically whatever they want to, it seems all but inevitable that serious genetic engineering of humans will begin as soon as possible. After all, there's a lot of profit to be made from it, and in the time it takes an "ethics" council to judge something illegal the corporations will have already done it.

    What will knowledge of our genome allow us to do? Firstly it'll be "improving" our children, removing congenital defects and then enhancing their natural characteristics. What then? Inter-species transfer of genetic materal so enable children to do things that God never intended them to do? This may seem somewhat farfetched, but the hubris of scientists and the greed of corporations guarantees that all this, and more, will happen, and sooner than you'd think.

    Personally I believe that allowing this kind of work to take place in any situation is dangerous, but allowing the corporations, Satan's tools on Earth, free reign to "experiment" with this is practically placing a gun to your head and pulling the trigger. The Government, whilst having unfortunate liberal tendancies, at least has the decency to try and do the right thing.

    No, genetic engineering is likely to turn out to be a disaster in the making - who wants everybody to be the same? When we've turned to world into 6 billion clones, then there truly will be no turning back.


    ---
    Jon E. Erikson
  • The scary thing is the (at least) 2 very divergent paths that are now in place. Either this could bring about a utopia, where retrovirii bring everyone to a perfect state, or a distopia where everyone is brought down to the state of a mindless drone while a few perfect beings rule over everyone.

    more likely to happen is somewhere in between. as long as companies dont get too profit crazed, then the future might actually have a chance... we have seen this problem with drug prices now....

    if you have not seen the movie GATTACA you might want to... this is what _could_ happen.
  • by Anonymous Coward
    So the HGP and Celera have managed to sequence the geonome of a single person. This doesn't really address the fact that there are variations on genetic sequences even those that code for important proteins. Some of these variations cause problems but others don't. Although HGP is attempting to sequence the geonome's of 4 different people in other to get this variation, this doesn't really capture the distributions across different ethnic groups. Getting that is problem that is even larger than sequencing a few geonomes.

    It's far more problematic than that. The HGP, for political reasons, isn't sequencing 1 person. They're sequencing a chimera constructed of anonymous samples from 12 people (and counting).

    As for diversity, that's what the Human Genome Diversity project is for. Unfortunately, it's pretty much dead, all in the name of political correctness.

  • ...Exactly what this means in plain english? Does it mean that if you can get away with it, you can choose a foetus' eye colour, build, metabolic rate, penis size? (Sorry, Gattaca screened last night).

    What does it mean? Or have they just mapped where the gene for hair colour is, and don't know how to change it, or...???

    Am I the only person who doesn't know?

    Gfunk
  • "The rough draft has been completed several years ahead of schedule thanks to the introduction of new robotic technology and the competition Celera gave the HGP when it started work in 1998."

    The way we're being forced to do it to try and minimise the genome's exposure to patent applications is completely necessary, but an utter pain in the arse. Most of the sequencing is being done in two phases - first producing a "draft" at reduced accuracy, and then going back to resequence each area and eliminating problems in a second pass. This is not the way anybody wanted to do it, but hopefully this second part will be finished on schedule by 2003.

  • by arivanov ( 12034 ) on Monday June 26, 2000 @03:42AM (#976712) Homepage

    No caveats. Sorry.

    Variations in the hunan genome has been subject of very intensive research since end of 1980-ties. The so called Restriction Length Polymorphisms have been used as a primary method for genetic diagnostics since and they are nothing but a manifestation of these variations. The exact differences are also usually well known. The data there can be correlated and joined with HGP. There will be need for additional research but no real caveat here. It is not as bad as you describe.

    Lots of math tough... Grin...

  • Remember that they have mapped A human genome, not The human genome, and that mapping is far from understanding.

    Move along, nothing to see here ... yet.

    Thad

  • I'd rather get rid of the troll gene.
    Or the "Me too" gene.
    OR THE I AM ALWAYS SHOUTING GENE
    Or the I'll be cute gene;-)
    wecoyote writes
    ABC News [abcnews.com] has an article [go.com] on the completion of the Human Genome Project. Apparently, there is supposed to be a presidential announcement this morning regarding the accomplishment.
    Or the pointless pasting of message gene.
    Or the I forgot to close my HTML tag gene
  • If they patent or copyright this stuff, the documentation to MY dna, I'm going to shit.

    I can see it now. No one can have a baby with OUR DNA, its DNA PIRACY! you must pay a royalty.

  • In principle we could build a specialized human being that will be able to do fast computations of pi, e and of prime numbers at a speed unattainable to a normal computer.
  • [slashdot.org]you lose
  • Maybe this is good news for the development of medicines, but this is one side of the coin. If you can create a cure based on a known genetic "defect", then you can also say that you cannot produce a cure for a known genetic "defect".

    Will this lead to penalties for those of us who possess a gene which causes an illness or death? For which, even with the access to the human genome, is deemed incurable.

    I can't imagine any insurance company offering insurance on these terms. Legislation is being considered at the moment, but one of the problems with legislation on some occasions is it appears to be driven by commercial interest.

    We should all be concerned about genetic privacy, there is nothing else which is more personal to us all.

  • The problem with the HGP is that raw data is being generated faster than anybody can analyze it. Already, numerous microbial genomes and the fruit fly genome have been sequenced, but mining the data for useful information is an extremely time consuming and difficult process. Even with the human genome sequence complete, it will probably be many years before genetic treatments are offered.

    In order to create genetic treatments, scientists must determine the location of genes that produce groups of proteins that are contributing factors to disease. Dividing the genome into functional subunits, individual genes, can be a long an error-prone process. Even after a gene is discovered (and likely patented--unless we stop Congress from allowing gene-patents), an effective treatment must be developed. Then, the treatment must be tested to comply FDA regulations--another long and expensive process.
  • <P>This means that there is a reference sequence covering 95-97% of the human genetic complement. It doesn't in itself address the variation between individuals, although this is also being investigated in separate projects. Matching specific sequences to specific disease predispositions is being researched in yet another project . . . but the reference sequence is necessary to make much sense of any of these others.
  • Didn't they fully map another species a few years ago? I forget if it was a planarium or some other simple animal, but I remember being really impressed because they actually knew what every single one of the genes expressed...
  • In Mid March Slashdot had an article about President Clinton and PM Tony Blair wanting to make the Human Genome free to the public. This ABC article though mentions that Celera is already charging companies for the Data how is that free? Has anybody seen anyything on making the Humane Genome Open and available?
  • Yes, it was the Cure for Cancer "wonder of the world". Increased happiness in all your cities.
    <sigh> If only it was really that easy.

    If I'd designed Civilization, you'd have had an extra population type called "lawyer" (to go with the taxmen, entertainers and so on they had), which would do nothing but drain resources and divert otherwise useful members of your population from actually doing anything constructive.
    Getting the "genetics" tech advance would have doubled the number of lawers.

  • The final sequence will be better than 8x. Today we have an earlier version at a lower thickness. The work is continuing to bring the thickness up, and resolve ambiguities and sequence gaps. We hope to have it finished early in 2003. And that's finished finished, not just mostly finished.

  • I really think that the widespread use of genetic engineering can only turn out to be a mistake of the worst kind.

    That is a very big accusation for something so new.

    Unfortuately, given today's socioeconiomic structure in which corporations have, thanks to America's love-affair with hardcore capitalism, the power to do practically whatever they want to, it seems all but inevitable that serious genetic engineering of humans will begin as soon as possible. After all, there's a lot of profit to be made from it, and in the time it takes an "ethics" council to judge something illegal the corporations will have already done it.

    Well, there are already laws in place that put restrictions on the extent of experiments with humans. For example companies need to get explicit licenses to clone human tissue even if it is only for medical purposes. And even if what you describe happens, i.e. someone finds a loophole and does more experiments that they should really be allowed to do, new laws can put in place that will prevent this thing from happening again (even though it has happened once).

    What will knowledge of our genome allow us to do?

    Primarily it will help us cure disease. I am not prophet though, so I cannot exclude with certainty any scenario including the more far fetched ones you describe. However I am an optimist: the condition of life of the human race have been improving, especially when new technologies are invented, so I have no reason to believe that this particular one will be bad. People were predicting that computers would be our downfall, but so far they have only improved our lives.

    As for the corporations being Satan's tool, yes I agree that they can be greedy, but they have brought a lot of innovations. Governments on the other hand are ideal examples of bad management.

    Je vous embrasse,

    Philippe Garnier.
  • It's in Alpha Centauri with the effect of one extra talent per base, but I don't remember it in any of the Civ(I,II,CTP) versions. However, I may well be wrong.
  • Remarkably, all humans (and in fact, all known life) shares the same DNA structure.
    The genome project is like a large dictionary (which lists the words, but the meanings are not filled in); in other terms, it lists all possible arrangements of DNA, but this is like a race to the start line, now they have to actually figure out what each sequence means.
  • I think it should be released into the Public Domain. NO license whatsoever. nada zilch
  • Does it mean that if you can get away with it, you can choose a foetus' eye colour, build, metabolic rate, penis size?

    No, not yet, although at some future point this may become possible. The sequence we have will be very useful for those studying what it is in our genes that affects all of these traits, though. Research into these things will go a lot faster from now on.

    (Sorry, Gattaca screened last night).

    Good film. Quite insightful.

  • It seems like alot of people see genetics as a panacea for all human ills. However this overlooks the fact that the environment is just as important as genetics. In some respects, the attention that whole gene therapy is getting resembles the hype that surrounded radiation in the early 20th century when radiation was going to cure anything and everything.


    Well we bloody well have to start somewhere now don't we?! Geez, be patient, they've really just started looking into genetics, if it takes another hundred years to figure out how it all works we'll still be doing good. Yeesh, No one is claiming this is the be all end all of medicine, but it's a damn good step in the right direction for understanding how our bodies work.

    Kintanon
  • Want to see something interesting?

    Go to this page [nih.gov] within the Entrez browser of Genbank [nih.gov]. Click Begin Download...and watch:

    >gi|8134254|ref|NT_001039|Hs22_451| Homo sapiens 22q11.2 sequence /len=1790785 TTTGGCTAAAACCGAAATCAATTATGAAGCAAAGGAAGTGGATTAGAGGG AGATCTTATG AAATCCCATCAGATTTGGATCATGCTACTGAGTTTTTTTCTTCCTGGCTG TATTTTAGGT TTTCTCTCCCACTGAAACTGATTAATCGTTGTCAAAATTCCTCCCTTGTA CCCTTCTCTC TATGGGAGGGCTGTCCCTTGGCTGGCCTGGGATGCAGGAATAGCTTTTGT GCACCCTTTG GTGTCCACTTCTGTGTGTCTCTCTTGGTGGCACTGCTTCCCTATCTCTGC TTGCTCTGAC CACCTTCAGGCTCCTAGGACCCTACCCTCTCAAATTTCCTCCTCCCCTGC GTCCCCCTTT CCCATTCAAAGCCCACAGCACATCTCAGTTAGTGCTATGGAAAAAACTAG CCTCAGAAAC GAATATTCACTGACATGTCAAGGTCTAGTAGTTTGTAGAGCCATTTTATT GGAAGGGACT TCAGAAAGGAATTAGTTTACCTACTCATCAGGTGAGGAGACCCACAGAGG GGAAGTCACC TGCCTGACTCCCAGAGACAGAAACAGTGCTGGGACTAAAACCCAAGAAGG GTCCTGACTC CCAAGTCCCAGGAACTTAATTTTCCCCCAGGGAATGGCCCACCACCCACC CAGATGTAAA AACTAGAGACTCTGGGCAGCATTCTATCTCTATGCCAGCCTCCAGTCTCC TGTCTATTTT GCCTCCAAGATACATCTCTAATTTGCCCACTTTTCTTGAACTTCACATCA CCGATCTGGT ACAAGCCATCATCATCTCCTTGCTTGGGCCTACCAAGACACTAATCACTG TTCTTTTTGT TTCGTTTTGTTTGTTTTTGAGACAGAGTCTCATTCTTATCACCCAGGCTG GAGTACAGTG GCATGATCTCAGCTCACTGCAACCTCTGCCTCCCATGTTCAAGCGATTCT CCTGCCTCAG CCTCCCAAGAAGCTGGGATTATTGGCATGCGCCACCACACCAGGCTAACT TCATATTTTT AGTAGAGATGGGGTTTCACCCTGTTGGCCAGGCTGGTCTTGAACTCCTGA CCTCAGGTGA TCCACCTGCCTCGGCCTCCCGAAGTGCTGGCATTACAGGCATGAACCACC ATGGCAGGCT GACTTTCATTCTTTCTCTAGTATTATTAGAATATTCCCAAATAATATTCC ATTGTGTATA TATTCCACATTTTGCTCATTGGTTTCTCATGGTCCGATCTGAGCTTTGGG TAGATCTGGC TATAGGCAGATAATCCCTGAGACATACTGCTAAATGGGAACAGCAGATGC AGAACAGTGT GTATGATACGCTACCACTTCTGCTGGAAAACGTCAAACAGGCACGTGTGC ATACATATGT ACGTGGACTTGGAAAGGCATAGACCGTCTTTGAGAATACTCAAGAAGTGG TTATCTTGGG TAGGAGAGCTGGTGGCGGGGGACAGAAATGGAAAGGAGACTTATTTTTCA CTGGATATAC TTTTGTACATTTTATGGCTTATTAATAATGATTTTATAATTATATTACCA TGATCAAATA AAACCCTTGGTGAATCTTCAATATTCAATAAAAGGCTTGGTTCTTTTAAG CACATATAAA CTTTTTTTTTTTTTGAGACAGGGTCTTGCTCTGTCACCCAGGCTGGGGTG CAGTGGCACA ATCTCTGGCTCACTGCAGCCTCTACTTCCCAGGCTCAAGTGATCCTCCCG CTTCAGCCTC

    And so on, so forth, for 33Mb worth...Chromosome 22.

    It's a bit dump, folks, with two bits per character. That's it. cat /dev/sequencer | gendump. (Yeah, yeah, abuse of unix commands. Too simple to resist.) Of course, what made this so ungodly difficult was the getting the sequences straight--vast amounts of data, no headers, and a flaky character mode device. Not simple to get this data; they essentially needed to repeatedly run the data through the analyzer and look for patterns which constantly repeated to determine how everything lined up within the chromosome.

    We don't know what any of it does, of course. We have ideas, implemented using the crudest of methods. The last time I tried to figure out what a piece of code did by commenting it out, I actually felt pretty good about myself--that's what genetics researchers do, and it is what they're wanting to patent, right or wrong.

    We've got the bits. Now we've got to figure out what they do. The entire field of computational biology has been created to decode this mess...I'm truly looking forward to seeing open source genome analysis tools come out of this.

    Open Source analysis of a system within which Source has never existed. That should be interesting.

    Entertaining tidbit: The CEO of Celera will likely have his own genome sequenced and released publically. Contrary to popular belief, this has nothing to do with the Human Genome Project's threat that "your ass is mine." (Kidding ;-)

    Yours Truly,

    Dan Kaminsky

    DoxPara Research
    http://www.doxpara.com
  • Have you by any chance ever seen the movie GATTACA with Ethan Hunt and Uma Thurman? One might be worried about the possibilities of a dystopian future similar to Huxley's "Brave New World" or similar stories; but one could also see a future where no one has any disability or genetic disorder. The issue is Therapy versus Enhancement. We can use the knowledge provided by a genetic map and knowledge of cell patterns to provide a blind child with new retinas, or an old man with a new kidney. Or we may use this knowledge to make every child a superhuman with the genius of Einstein, the body of John Elway (obviously there are different examples for females), and the creativity of Van Gogh (without the tendency for ear-chopping.) The problem is when this line between therapy and enhancement becomes blurred. Is it therapy or enhancement to provide someone with less-than-stellar vision (but not blind) near-bionic eyes when they could have their vision corrected by contact lenses or glasses? This issue may seem obvious to some, but there are several other issues you can think of if you put your mind to it. While we have just gone through a digital revolution, we are about to undergo a biological revolution. The problem is the ethics of biology are much less clear-cut than the ethics of technology.
  • Inter-species transfer of genetic materal so enable children to do things that God never intended them to do? This may seem somewhat farfetched, but the hubris of scientists and the greed of corporations guarantees that all this, and more, will happen, and sooner than you'd think.


    Trust me, if God doesn't intend for it to be done, then it won't happen. But if you believe in God, then you believe he put us here to have dominion over the earth and all of its creatures. Well, we're one of its creatures, so we have free reign to improve or destroy ourselves as we choose. Now yes, complete free reign to tinker with peoples genetic code just for kicks might be a bad thing. But controlled genetic experimentation can be nothing but a good thing in the long run. Turning everyone into clones is in no one's best interest. Heck, making everyone immortal is a pretty BAD idea too considering. I'm not even for increasing the overall lifespan of humanity right now. We really need to expand off of this planet before we do anything that would increase the population dramatically....
    But back to the point at hand, yes there are potential problems with genetic engineering, but there are also great potential benefits. You must risk the one to achieve the other, that's the way life is.

    Kintanon
  • But on the bright side. He need never be sick ever again.

  • If I'd designed Civilization, you'd have had an extra population type called "lawyer"

    Not quite the same, but apparently there's a lawyer unit in Civ: Call To Power. Quite a useful unit too by all accounts.
  • I do not think you see my point. 100 years ago, people thought that radiation would would cure everything. But it didn't: not then, and not now 100 years later.

    Again people are making the same mistake, they say that genetic treatments will cure everything, ignoring other factors such as the environment. I agree that it has very big potential, but we should be more cautious before making such statements.

    Philippe.
  • The announcement today concerns what people are calling a draft sequence. For various reasons, this isn't regarded by those involved as complete, or as adequately accurate for work to be wound up. The original plan was to sequence the entire genome to a depth of about 8-10 reads. This is still the plan, but a halfway station has been created in the middle to try to forestall some of the patent applications, and that's what's being announced today. Rather than being 8-10 reads deep, this is 3.5-5 reads deep, and over most of the genome no effort has yet been made to solve ambiguous areas or fill in the gaps in the sequence. Over the next three years, this will be brought up to the standard originally planned.

    Celera are, as best as I can tell, announcing their assembly of the same HGP data plus about 3-4 read deep sequence data of their own. It's unclear how much or when this will be made available to the public, although Celera are committed to doing so at some point. They may announce a timescale today.

    Regardless of all of this, both the public-sector HGP and Celera (and, for that matter, various other companies) are continuing work on the human genome. Celera are sequencing the DNA of (IIRC) six individuals to analyse for variations between them, and the HGP have a similar project under way. The HGP are continuing to increase the depth of coverage of the main genomic sequence, and are continuing with specific problem-solving work on difficult or ambiguous areas. Both will be sequencing other genomes for comparison - mouse looks to be first, although apparently somebody's intending to do the chimp genome as well.

    So in summary, it's all go around here. This isn't a big final announcement, although it is very significant. It isn't in itself going to change your life, but it's going to be very useful for lots of work that is going to. Concrete results will start flowing over the next few years, and where it will take us, I'm not even prepared to speculate.

  • I really think that the widespread use of genetic engineering can only turn out to be a mistake of

    the worst kind.

    Mmm ... not so clear. First of all, we have been using genetic 'engineering' since time began (think of mate choice) and since the Mesolithicum (think of crop and cattle breeding). Also, so far, no examples of transgenic engineering (transfering
    genes from one species to another) or even invidual directed gene transfer in humans has been shown to be feasible, let alone desirable. Given the reaction towards Dolly the Sheep Cloneage, it seems very likely that any such technique will be forbidden, and I will probably agree. I will, however, vehemently advocate the use of genetic therapy (if they become available) for the 'definitive treatment' of very obvious heriditary diseases (such as metabolic defects (cystic fibrosis etc.). Unfortunately it's not clear-cut when a disorder is a disabling disease, I admit.

    What will knowledge of our genome allow us to do? Firstly it'll be "improving" our children, removing congenital defects and then enhancing their natural characteristics.


    Again, it's not that simple. Your 'improving' has been a possibility ever since we started studying chromosomes; this allowed ever better pre-natal diagnostics, with the obvious possibility of terminating pregnancies for foetuses that might have a more or less severe disability. I am not at all convinced it is morally repugnant to avoid suffering in very serious cases (the big question, of course, is what is 'serious').



    So far, most techological advances have been put to reasonable use in democracies . (I think Popper came up with this) There will have to be a great deal of public education about matters (to make sure democracies keep getting it right).


    PS: rants about God, Satan etc. do not inspire much confidence in the likelihood of a serious debate on these issues, which indeed is very necessary.

  • Isn't this one of the last advances to completing Civilization Call to Power?

  • If Moses were to get that special download today, would God have added:

    Thou shalt not reverse engineer the genome of man or any other creature.

  • There is, of course, one non-scientific obstacle to effective treatment for genetic disease. Whilst it is becoming ever more possible to detect and treat genetic defects on a somatic basis the net effect of this is to increase the percentage of the population that carries the gene in question. Germ-line genetic therapy will never be allowed to happen. The right wing condemn it as being man "meddling in Gods domain" the left wing paint a "brave new world" style apocalyptic vision based on institutional abuse of the technique. With todays techniques this leaves only pre-natal detection of genetic abnormality and guess what.. now we hit the abortion debate. So where can we go in the future? Probably gamete screening is possible but I predict the same problems with that as with germ-line therapy. Sad to say there is more FUD spread around on the subject of molecular genetics than has ever been generated in Redmond....
    # human firmware exploit
    # Word will insert into your optic buffer
    # without bounds checking

  • So you're saying that I'm a (Score: -1; Funny)?

    kwsNI
  • So, who won?
  • Along with the many "so called" befits this new advance is supposed to bring will come new ways to discriminate. Imagine not being able to get lifeinsurance or health insurance when you are 20 because they determined you have a genetic disease. Then, of course, you have the genetic databases that will eventually be built. Eventually, they will try and link behavior to your genetic profile, and this will incourage more databases and more discimination.

    The future looks like so much fun!
    -------------------------
    I wish vacations were longer. A time machine would definately be handy right now.
  • Open Source analysis of a system within which Source has never existed. That should be interesting.

    To believe that no one has ever held the "source" for humans and other living things is akin to believing that you could find an intricate piece of machinery (a watch, for example) lying on the ground that had somehow assembled itself and was designed by no one.

    I believe that our source exists, we just haven't met the programmer yet.

    Best regards,
    Daniel McCarty
    --

  • The Alien Overlords that Transmeta got their technology from have had that technology for years. They probably outfit all their new-hires with prehensile tails as soon as they sign on. Why do you think they're so damn secretive?

    ;-)

  • "I'm concerned that some day we may decide to start modifying the human genome to think that we can do better than the genome," [Eric] Lander said.

    Dammit, my kids have a right to have that fur coat and prehensile tail. Evolution has slowed to nearly a stop ever since we got the dumb idea of breeding based on brains instead of being able to better outrun the hyenas. We need to fix that and get back to evolving towards greatness.

  • Increases unit strength and city production by 10% in Civ:CTP, if I recall correctly.

    Scary thing is, I didn't need to go look that up.

  • Actually, they have mapped *the* human genome. There are about 3 billion possible 'letters' (ie. combinations of the four base amino acids, and they have charted them all.
  • O.K., so we have the ROMS, now who is going to write the emulator? Make sure it supports zipped rom sets :)
  • I do agree with you... however, would the phrase within which no human-readable Source has ever existed be better? It's much the same problem, and source code exists merely as a meeting of the minds between computers and human. There's no meeting point here, no easy answers, no cheat sheet, just pure A, G, C, and T.
  • Quite hardly. Currently, our civilization is a Type 0 civilization. We have not met enough of the criteria to be considered a global, or Type 1, civilization. Not to mention the fact that even after we master the planet, we will still have 2 more phases to go through.

    Or were you talking about a game?
  • When they announced the fly, worm, yeast
    and human chromosome #22 and #21 genome,
    they were about to give a 99.9% accurate count
    of the genes and rough protein classification.
    Today's announcement doesn't do that.

    Some interesting issues to resolve with the count:
    1) The numbers are all over the board, between 35,000 to 150,000 genes. The low end was triggered by a low #21 count. In fact there is a contest to see who has the best prediction.
    2) More is not necessarily "more evolved". From a count of genes and proteins, the worm is 25% more complicated than the fly. Where do humans fall into this range.
    3) Its interesting to see how many genes humans shared with these other sequence organism. The majority of known genetic cancers have exact genetic analogs in these other organisms.
  • All the caveats are true, however, for many people just the knowledge of the gene sequence will be important.

    I am the parent of a child who has lost the ability to walk and talk and care for herself over the last 12 years. After years of extensive testing, we still have no diagnosis. The ability to compare her DNA with "standard" listings may give us some answers.

    For me, anything that advances our knowledge is a good thing.

  • Again people are making the same mistake, they say that genetic treatments will cure everything, ignoring other factors such as the environment. I agree that it has very big potential, but we should be more cautious before making such statements.



    Show me who is saying this is a cure all for everything? Everyone is saying it has huge beneficial possiblity, and could mean the end of many diseases and defects. Those statements are true. It COULD be. Radiation has done a lot of good in treating things like cancer. It didn't cure it all, but it helped a lot. And if someone had said, 'Well, it didn't cure everything, so lets just forget about it.' we'd be worse off for it. I have yet to see one statement to the effect that this is a complete cure all for disease and defect.

    Kintanon
  • The newer sequence robots determine thousands of
    base pairs per day- much faster than before.
    However, there is a limit on maximum piece size.

    Supercomputers determine the connections between pieces. The government approach is more cautious in regards to breaking the genome into pieces. consider the anology of breaking a skyscraper's windows into granular pebbles, each which can be automatically sequenced. The government gave each floor of the building to different lab. In turn each lab goes window by window, shard by shard at a time. Celera basically just pulverized the entire building at once and are reassembling the pebbles simultaneously. They compute quadrillions of comparisons of each pebble with each other to discover how they fit together. People thought this was crazy, but this worked on animals with as much as 10% of the human genome.

  • To believe that no one has ever held the "source" for humans and other living things is akin to believing that you could find an intricate piece of machinery (a watch, for example) lying on the ground that had somehow assembled itself and was designed by no one.

    Whoa there, McCarthy. I'm not saying there's no God, or Allah, or Yehova, or anything else of that nature. I just prefer not to limit that guiding force to any single moment of creation, saying that It(the correct pronoun doesn't exist) needed to have all time and all thought forged at once.

    What could be more interesting to a Creator than a universe he did not Create? Think about that. Think about how cool self-optimizing code is to us hackers. Look at the talk of genetic algorithms. Are you saying we can pull off stuff our own creator can't?

    Actually, that'd be really interesting wouldn't it...

    (I actually wouldn't have replied to this, but I've been having an inordinate amount of fun reading the online comic strip Acid Reflux [acidrefluxcomic.com], which really should be read from the beginning [acidrefluxcomic.com] but has a pretty good summary right about here... [acidrefluxcomic.com]call me a blasphemer if you like; I just love the concept behind this strip!)

    Yours Truly,

    Dan Kaminsky
    DoxPara Research
    http://www.doxpara.com
  • genome@home ?
    NT
  • No, genetic engineering is likely to turn out to be a disaster in the making - who wants everybody to be the same? When we've turned to world into 6 billion clones, then there truly will be no turning back.

    Why would genetic engineering make everyone identical? Thats preposterous! Its like people who think that cloning allows you to put someone in a box and get an exact copy at the exact same age!

    The only big problem I personally see with genetic engineering is the possibility of making a serious mistake which spreads to every human being on the planet. Something subtle that would eventually come out, resulting in our extinction. There's a science fiction story (probably several) that mentions something similar to this. Ahh, yes, thats right, one of the Rama books by Arthur C. Clarke mentions a race that made changes to its genome and lost the original copy, so when they noticed the error that was killing them all, they were unable to do anything about it.

    I don't see why we SHOULDN'T give our kids more intelligence, durability, as long as we don't manage to find out how to extend our 100 or so year limit before we simply wear out. And even that may be a good thing eventually, if we can manage to get off this planet and have somewhere to send all these people. (If no one died, population would grow at an even more insane rate than it is doing now)

    It is unfortunate, however, that ramblings about God or Satan or evil forces which attribute a certain mysticism to cutting edge biology are very characteristic of the populace of America, and likely the developed world. While the religious argument is not necessarily universal, I know for a fact that most people's reactions to things like cloning are not level with the reality of the science. These sciences gain a magical quality, a romantic sense of tampering with something imperturbable and divine. To most people, genetics, and much of today's more advanced science, is something to fear, something that transcends understanding.

    And this unfortunate fact is why I fear the true potential of many sciences may never be met.

    -Dobbs

    -Phredrick Dobbs
    Emperor of the Universe
    Grand and High Protector of Everything

  • by Guppy ( 12314 ) on Monday June 26, 2000 @05:54AM (#976775)
    As the HGP and Celera finish up the first draft of the human genome, I thought I'd mention a second interesting mapping project that's just starting up now.

    All life as we know it uses the same four bases in its genetic code, A, T, C, and G. However, there is a chemical modification known as methylation, which changes the structure and behavior of the base C, cytosine. Methylated cytosine is considered by some to be a "fifth" base. (Note--Adenosine can also be methylated, but mostly in prokaryotes only, I think). In mammals, about 2-5% of cytosine have this modification.

    The thing about methylation is that it doesn't affect base pairing, so G's will bind with either normal or methylated C's. The pattern of methylation can be preserved as DNA replicates, though, by the action of enzymes can methylate and de-methylate cytosines. The pattern isn't static, though. In some places it varies at different times, and sometimes may be altered in different kinds of tissues. So you get a changes which sometimes can be inherited, and sometimes not, all depending on how the patterns shift.

    Just recently, a European consortium known as the Human Epigenome Consortium (HEC) was announced to identify these methylation patterns. It's a task which is on the same scale as the HGP, but it's not as well known so I don't know if they'll be able to attract as much funding. Here's a link to an article on the HEC [apnet.com].
  • by Cliffton Watermore ( 199498 ) on Monday June 26, 2000 @05:54AM (#976776) Homepage
    The article in itself is interesting, the Human Genome Project is indeed a big milestone. However, a few of the things mentioned in the article disturb and annoy me, to be quite honest.

    Each genome contains 30,000-100,000 genes containing the basic information that makes us who we are: the color of our eyes, our intelligence, the disease to which we are susceptible and more.

    No argument with most of that, colour of eyes and disease-proneness are identifiable. Intelligence? That's utter nonsense. I've been working in this area for many years, and if anything, there are still more questions that have to be answered than answers themselves. We don't know how intelligence works, yet. We aren't there. We don't know if it's mainly genetic software (as this article just assumes, without proper consultation), wetware, or something chemical. The very definition of intelligence is in question. IQ tests prove nothing, and Academic tests are almost as useless.

    I was contracted by a firm in the UK in 1995 to design a new generation of SQUIDS. Basically, what a SQUID (Superconducting Quantum Interference Device Scanner) does is convert electrochemical impulses into instructions. This way, scientests can analyze instruction patterns and try to better-design atrificial intelligence systems. I think that experience, and my academic qualifications, qualifies me tenfold to discuss this topic - there's no way intelligence is entirely genetic. Certainly genetics affects it, but to say that you can define intelligence totally by genetic mapping is utterly ludicrous, and I will take anyone out there up on that.

  • by Guppy ( 12314 ) on Monday June 26, 2000 @06:08AM (#976780)
    That's funny, I tried looking at Celera's sequence, and got the following...

    >gi|8134254|ref|NT_001039|Hs22_451| Homo sapiens 22q11.2 sequence /len=1790785
    FIRSTPOSTAACCGAAATCAATTATGAAGCAAAGGAAGTGGATTAGAG GGAGATCTTATG
    AAATCCCATCAGATTTGGATCATGCTACTGAGTTTTTTTCTTCCTGGC TGTATTTTAGGT
    TTTCTCTCCCACTGAAACTGATTAATCGTTGTCAAAATTCCTCCCTTG TACCCTTCT...
  • Apparently, there is supposed to be a presidential announcement this morning regarding the accomplishment.

    ...at which time Al Gore will describe how he invented the human genome project.
  • Jeezus, can't you guys give this a rest? There ought to be a moderation category for kneejerk Al Gore/Internet jokes.

    Al Gore's original utterance on this is no less believable than the run of the mill political claim to having created jobs, or protected family values, or defeated communism. They say these things because we demand they lie to us; half of us because we want to be lied to, the other half because we don't trust anyone who isn't willing to be a baldfaced liar.

    Is it the politician's fault that the electorate is collectively too stupid to realize that its often better to do small things to remove barriers to something that is on the verge of succeeding, than to try to create big successes out of thin air?

    Now, HGP was started in the Bush administration, so the Clinton admin can't claim to have created it. But why shouldn't the administration take credit for standing behind HGP for all these years? Should Nixon have forgone calling the moon because most of the work had been done in prior administrations?
  • TTTGGCTAAAACCGAAATCAATTATGAAGCAAAGGAAGTGGATTAGAGGG AGATCTTATG AAATCCCATCAGATTTGGATCATGCTACTGAGTTTTTTTCTTCCTGGCTG TATTTTAGGT TTTCTCTCCCACTGAAACTGATTAATCGTTGTCAAAATTCCTCCCTTGTA CCCTTCTCTC TATGGGAGGGCTGTCCCTTGGCTGGCCTGGGATGCAGGAATAGCTTTTGT GCACCCTTTG GTGTCCACTTCTGTGTGTCTCTCTTGGTGGCACTGCTTCCCTATCTCTGC TTGCTCTGAC CACCTTCAGGCTCCTAGGACCCTACCCTCTCAAATTTCCTCCTCCCCTGC GTCCCCCTTT CCCATTCAAAGCCCACAGCACATCTCAGTTAGTGCTATGGAAAAAACTAG CCTCAGAAAC GAATATTCACTGACATGTCAAGGTCTAGTAGTTTGTAGAGCCATTTTATT GGAAGGGACT
    I read this and all I saw was:
    GATTACAGATTACAGATTACAGATTACAGATTACAGATTACAGATTACAG ATTACAGATTACA GATTACAGATTACAGATTACAGATTACAGATTACAGATTACAGATTACAG ATTACAGATTACA GATTACAGATTACAGATTACAGATTACAGATTACAGATTACAGATTACAG ATTACAGATTACA GATTACAGATTACAGATTACAGATTACAGATTACAGATTACAGATTACAG ATTACAGATTACA GATTACAGATTACAGATTACAGATTACAGATTACAGATTACAGATTACAG ATTACAGATTACA GATTACAGATTACAGATTACAGATTACAGATTACAGATTACAGATTACAG ATTACAGATTACA GATTACAGATTACAGATTACAGATTACAGATTACAGATTACAGATTACAG ATTACAGATTACA GATTACAGATTACAGATTACAGATTACAGATTACAGATTACAGATTACAG ATTACAGATTACA

  • The most impressive discovery connected with the completion of the Human Genome:

    Take the completed code of the Genome and convert each ACGT into its binary equivalent as follows:

    A 00
    C 01
    G 10
    T 11

    Then, convert the binary code to ASCII, so that the Genome now exists in Arabic letters and numbers.

    After doing these conversions, amazingly the Human Genome encodes the entire text of Cryptonomicon, by Neal Stephenson. Either Stephenson is some sort of prophet, or a blasphemous plagiarist!


    -----------------
  • I'm not saying there's no God, or Allah, or Yehova, or anything else of that nature. I just prefer not to limit that guiding force to any single moment of creation, saying that It(the correct pronoun doesn't exist) needed to have all time and all thought forged at once.

    Please don't take this out of context; I wasn't really talking about deities. I'm only coming at this from the perspective of a programmer (or creator, if you will). It's illogical to my mind that we can understand simple things which we ourselves create, yet believe that complex things which we have yet to understand could have created themselves.

    What could be more interesting to a Creator than a universe he did not Create? Think about that. Think about how cool self-optimizing code is to us hackers. Look at the talk of genetic algorithms. Are you saying we can pull off stuff our own creator can't?

    Well, if I build a robot that builds a smaller robot, who is credited with the invention of the smaller bot? Me?--or my robot. Following the same line of logic anything that a created object builds (nanotech, for example) is credited to the original creator.

    I'm not trying to write flamebait posts (as my original was moderated). I'm only saying that your original comment--that no "source" exists for humans--is rather human-centric itself. To solve really big problems we must see outside of the boudaries that we've grown up inside: like the way you see my name, McCarty, and your brain tells your fingers to type McCarthy. I think the HGP is a giant step towards an eye-opening experience, and I hope we keep our eyes open to new ideas it might bring.

    Best regards,
    Daniel McCarty ;-)
    --

  • "'A' stands for adenine not adenosine..."

    Sorry. Had a brain burp there, you're absolutely correct.
  • Jesus Christ! Could you be any more blatant and cut and paste my comment [slashdot.org] some more. Why not just go through my posting history and cut and paste all my other comments in the appropriate discussion.

  • Here's the address for my post [slashdot.org] in an earlier discussion. This guy just cut and pasted it into this discussion to get karma. I guess he's never heard of intellectual honesty or properly attributing other people's ideas.

  • I do not think you see my point. 100 years ago, people thought that radiation would would cure everything. But it didn't: not then, and not now 100 years later.

    Your point? Seeing as how I wrote the post top level post which you decided to copy, I don't think you really have any cogent point on this topic.

  • All the articles I'm reading on this are comparing this feat to that of landing a man on the moon in terms of its importance. Well, that's all a matter of relative importance. I'm not old enough to have experienced it, but I'm hold enough to understand what landing a man on the moon meant. Hearing the stories of entire families gathered around a television during the landing and "one small step for man" speech put the perceived importance into perspective. People to this day remember where they were when Armstrong set foot on the moon. It's doubtful that people walking around the streets today will remember what they were doing when the Human Genome Project announced they had mapped the entire genome. It's really not that important.

    But history has a way of vindicating the worthy. We look back on the moon landing today and ask, "What did it get us?" We constantly bicker over the importance of the space program. We still don't have mining operations or hotels on the Moon and we while we may have several new products (Velcro, TV dinners, yay!), the benefit to the majority of humanity from the Apollo project has been minimal at best. Jump forward 30 years from today and imagine even a small piece of the world that researchers are promising us. It benefits far more people and has the potential to impact everyone, not just rich industrial service-oriented nations (I won't name names, but I do live there).

    So can you compare the moon landing and the genome project? No. The moon landing was about a people meeting a challenge and doing something strictly for the sake of doing it. The Genome project, on the other hand, is about understanding who we are and working towards a 'better' humanity. In that regards, these news services should really be comparing it to the Manhattan Project, although, hopefully, it will turn out a lot less violent.
  • First, I thought everyone had different genes? Isn't that what makes some people have blue eyes vs. brown eyes etc.? So if they map the gene sequence that determines eye color, aren't they mapping one person's gene sequence? I don't get it.

    Yes, but every human's genes are more than 99.9% identical. If they sequence one person's genes, then they have >99.9% of your sequence too.

    Now, knowing exactly where the differences lie, and what those differences mean, is not a trivial problem, and that will take years after the genome is completed. (Remember today's announcement is only that a "rough draft" has been completed.) But even though the HGP isn't copmleted, work has already begun towards identifying and mapping single nucleotide polymorphisms (SNPs). SNPs are one type of difference between people's gene sequences. Not the only type, but one of the most important, and certainly the most common.

    Second, how does gene therapy work? I saw a story on TV where they identified someone's defective genes and "inserted" good genes somehow. Well - how did they do that? Don't you have the same chromosomes in every cell? Wouldn't they have to replace all cells' chromosomes?

    Well, that's a difficult question to answer fully without getting into a graduate-level discussion of molecular biology. But I'll try to give some idea here. First of all, although (nearly) every cell contains the complete DNA of its organism, not every gene is "turned on" in every cell. Each gene codes for a certain protein, and so, although every cell contains the code for every protein, in any given cell most genes will be turned off, and the cell only produces a subset of its possible proteins. So part of the answer to your question is that the "correct" gene only needs to be inserted into the cells that would use it anway.

    Second, in many genetic diseases it's often enough to give a person some cells which produce the correct version of the faulty protein. For example, suppose a given protein was, normally, not used within the cell it was produced, but instead released into the bloodstream. A person that, due to a genetic defect, had *no* cells that made this particular protein would benefit from having *some* cells which produced this protein, even if most of their cells continued not making this protein. So (and depending on the particular defect, this is true for some and not for others) even for the subset of cells which ought to be making the protein in question, you don't need to get the "good" gene into all cells; it will be sufficient to get it into some of them.

  • > Variations in the hunan genome has been subject
    > of very intensive research since end of 1980-ties.

    I'm happy for all the Chinese people this will help, but what about me?
  • Hello fallacy of composition. The world is not a freakin watch, ergo there is no case for a watchmaker. I can't believe some people still buy this tired old theist argument.
  • The moon landing was many things, but the main technolgical reason to pursue a moon landing was that it was a palatable way to spend billions on missile technology.
    --
  • As far as I understand, the human genome project gives us the ability to say, "Wow! Jon Katz's gene #34289689 on Chromosone #23 is ATCA.. that means he can't produce any pseudochlorohydrolynanelanymine-B in the cell membranes of his T-x84dg white blood cells!

    Well, big holy shit.

    In a way, if I make a tired Linux analogy, I'd equate the "completion of the human genome project" with "figuring out how to type ls, going into every directory, and drawing the tree". Of course, the analogy is flawed because filenames are (slightly) intuitive; this would be more along the lines of finally being able to read the file system, when the average file was named "a0sd8fhj09bv".

    Give it a shot some time. Write a Perl script to rename every single file in Debian to a random string of fifteen characters. Then go get your mom, tell her that "ls" looks at files, and ask her to install Enlightenment.

    In conclusion, we're all a little bit too excited about this.
  • Aren't there a few people who can do this already?
    They are commonly called Idiot Savants but the more PC name is Autistic Savant. [autism.org]

  • Isn't that supposed to be the "Human Gnome Project"?

    So what's KDE? The "Klingon Decoding Endeavor"?

    ;-)
  • A Discordian plot, no doubt - the Law of Fives rears it's ugly head once more...

    Must...stop...madness...AGGGGGHHHHHHHHHH!!!!!

    jfkads;lkjfasldkf[wrqoiutwiqknjt/lknv;

    [EOT]
  • the problem with trying to map methylated bases is that there are shitloads of modifications to dna going on all the time. there is a whole classification of enzymes (kinases) whose sole function is to methylate or demethylate proteins and dna.

    kinases have been implicated in a very large number of biochemical pathways for practically every process. methylation is a regulation mechanism for dna. methylation is likely to change the conformation (shape) of parts of dna, allowing binding or blocking binding of proteins and consequently allowing transcription (or the lack thereof) to occur- in effect turning gene/protein activity on and off.

    this is important, but in any single organism over its lifespan thousands upon thousands of bases will get demethylated or demethylated. in fact, any individual gene is likely to be methylated or demethylated, and there are no doubt a significantly large number of genes which are methylated and demethylated many, many times over the organism's lifespan. this results in millions of possible sequences of bases which are methylated or demethylated.

    i just dont think this sounds like a feasible project. biologists right now tend to find out meth or demeth bases by studying genes or pathways one at a time. i tend to lean towards this approach as being more intelligent.

    (i kinda sorta paid attention in biochem class...but i could be wrong...)

    unc_
  • IMO, it doesn't mean much. It's largely hype, a symbolic milestone. It's akin to getting a bit dump of a binary program. The hard part will be to understand what it all means.

Mommy, what happens to your files when you die?

Working...