Forgot your password?
typodupeerror
Science

Human Genome Mapping Completion TBA 196

rit writes: "According to this CNN article, both The Human Genome Project and Celera Genomics, Inc., two groups who have been working on mapping the human genome, are scheduled to hold news conferences Monday in which they will announce the completion of the Human Genome. This should prove interesting, and makes me wonder: what will we do next?"
This discussion has been archived. No new comments can be posted.

Human Genome Mapping Completion TBA

Comments Filter:
  • by Tebriel ( 192168 ) on Friday June 23, 2000 @08:14AM (#979771)
    Mapping that region of space where that 1 sock escapes to from the dryer.
  • Spend years discussing the moral aspects.
  • Is that also where all those biros go?
  • what will we do next?

    I'm sure we'll find something else interesting to do.

  • mapping the the genome of other humans.
  • I wonder if the people working on the Genome project use GNOME (1.2) because it's so nice..

    Mike Roberto (roberto@soul.apk.net [mailto]) -GAIM: MicroBerto
  • Whenever a new life altering technology is developed, the same story plays itself out: the "benevolent" unitedstatesian "scientists" go to third world countries and use the locals as human guinea pigs. For example, birth control pills were perfected by studying secondary effects on Central American women who were given experimental pills without their knowledge. The US performed radiation experiments with Puerto Rican independence supporters. These are only two examples among many.

    What abominations await my "raza" now that the human genome is in their sights?

  • What we do next ought to be obvious. Corporations/organizations/institutions must get together and figure out how to use this ethically. Surely, if we can cure multiple sclerosis, can't we cure [your_least_favorite_skin_color_here]ness?
    That ought to be a high priority of all involved. Or if you mean, what will technology do next? Flying cars and colonies on Mars.
  • Let me check the timetable...

    Ah yes, then we start preparing the humans for the alien colonization and takeover of Earth.

    With this genome information, we can finally perfect The Black Oil!
    ---
    pb Reply or e-mail; don't vaguely moderate [ncsu.edu].
  • by YASD ( 199639 )

    Human genome done
    Now move on to real challenge
    Special hacker genes!


    ------
  • Mapping the genome means hardly anything... Which one of those strands is to blame for cancer? Which one is to blame for chronic backpaine? How about killer migraines? Or perhaps congenital heart problems? They mapped it, big deal. Now let me see the expert who will find what each of the billions of strands mean, and try to alter those. There are some discoveries already, but hardly any which would put prostate cancer patients at ease (i.e.). Good luck :-).
  • "Some scientists have said this breakthrough -- which comes 10 years after the project was started -- is as significant as man walking on the moon."

    We haven't been back to the moon in decades. Is the human genome doomed to the same fate? Now that we've seen it, will it simply be filed away and taught to third graders?

    Well. That is a bit ludicrous. Does anyone know what we actually can do with this information? Things like growing modified human clones (with, say, an eye in the back of the head) would never ever pass any kind of review board. What is the practical application of this work?

  • I work for one of the big pharmaco's. Over the last few months we've seen a serious acceleration in the amount of data coming in from these projects. They expect to have storage requirements of near a petabyte within 4 years as they crunch all this new data. Sun is going to love us...
  • If you were a real scientist, you would have realized that there is a door in the back of each dryer which leads to another dimension. Offhandedly refered to as the `lost sock dimension', this place is chock full of the stuff we lose in the dryer. Not to mention a ton of lint.

    The lord of this domain is a large createure I grew in my bathtub. I placed a peice of white bread over the drain and proceded to take showers (as normal) daily. The skin cells washed off during the normal task of washing collected in the bread, a matrix if you will. Eventually the cells started to create a new organism that quickly grew to about my height and became sentient. In trying to get rid of the `creature', I stuffed it into the dryer, making a weird situation even weirder.

    Anyways! To make a long story meaningless, I appologize for the lord of the lost sock dimension, but I feel my scientific exploration more than justifies any loss of life. Or loss of socks for that matter.

    Bad Mojo [rps.net]
  • I thought we had already figured this out? It seems to me that missing socks turn into coathangers. We never actually BUY coathangers, but always have too many...
  • by Mignon ( 34109 ) <satan@programmer.net> on Friday June 23, 2000 @08:24AM (#979786)
    Mapping the genes is the easy part; figuring out what they do is the hard part.

    I predict that as these functions are identified, genetic research companies will patent tests for specific genes (if not the genes themselves.)

    As a result, actually getting the benefits of these tests - like early warnings for predicting diseases etc. - will cost way more than it otherwise would, in order to pay the license fees the patent holders will demand (kind of like how brand-name drugs cost more than generics.) People with insurance that covers such tests will be fine, but people will find it harder and harder to get insurance as companies begin raising rates based on the results of such tests.

    Some European countries will pass laws preserving individual rights to privacy which will prevent such behavior from insurance companies, but in the US it will take abuse from HMO's and insurance companies before Congress passes laws providing a weaker form of protection.

    Of course, my crystal ball may be on the fritz. Check back in a few years and we'll see if any of this comes true... ;)

  • The Human Genome Project [nih.gov]
    Celera [celera.com]

    Neither of them seems to have reported anything on the news conferences, though.

    -hk

  • Notice that the two organizations have separately made maps. The next step will be scanning for differences between them... After that everyone will be looking at the details of what the exact structures are for different chemicals and which genes are different in people with different traits.

    The map is not the territory. We'll now know where the countries are on the continent, but we need to know where every road is and what the differences are between countries.

  • You're too late. I already own wakingupinthemorning.com/net/org and breathing.com/net/org. I'LL SEE YOU IN COURT.

  • by orac2 ( 88688 ) on Friday June 23, 2000 @08:25AM (#979790)
    ...and the real battle for IP is just beginning too. The real work will be turning the sequence into useful information. First what and where are the actual genes, then what proteins do the genes code for and what role the protein plays in metabolism or regulating other genes. Some idea of how much work needs to be done can be gathered from the fact that we don't even know how many genes there are - the most recent estimates for the total number of genes range from about 40,000 to 120,000. This process is called "annotating" and will take years. It's also where all the money lies, since this is what'll be patented as part of biotech companies' IP. Plus, even now, there are tensions (as discussed in this weeks Nature, between the people who are producing the sequences and the people who are analyzing and annotating those sequences. On the one hand, some researchers are dedicating their time to sequencing as quickly as possible and so don't get the chance to follow up anything interesting they come across, on the other hand, just how much credit should they get for providing the raw data for someone else work in annotating?

    Finally, don't forget this is just a first draft - there's still a lot of donkey work required to map out tricky regions and to verify already covered regions.

  • by TrevorB ( 57780 ) on Friday June 23, 2000 @08:25AM (#979791) Homepage
    Celera and the government funded Human Genome Project are going to announce project completion simultaneously. Surely this is political. The question is, which one of the two is the "most complete"?

    This project is probably equal or greater in scale to the Manhattan project in it's potential effect on humanity. For the next 50 years, we're going to be worrying how bio-genetics will be misused while reaping the benifits of a new revolutionary technology. I wonder what will be the equivelant of "duck and cover"? Hold your breath for as long as you can?

    Humanity's revolution for the next two decades to be feuled by bio-genetic discoveries, not by advances in computing power (not that one didn't catalyze the other)
  • When the project started a few years ago, the world was excited by the possibility of knowing what every single gene in humanity did. After all, if we understood what is is that makes a human a human, perhaps we could cure genetic disease and maybe someday improve ourselves...live for hundreds of years, whatever.

    What most people fail to grasp, however, is that the Genome project is only the first and earliest step in this process. Sure, we have mapped the human genome, but we still don't know what most of them do. There could be 40 different genes that affect height, for instance, and the only way we have used in the past to figure out which genes do what is to screw around with genes in an egg and see what kind of baby comes out of it, like in fruit flies or mice where thousands of genetic experiements have been done in the past. I hope it goes without saying that this research technique is not possible in humans.

    However, we still want to learn the functionality of our genes eventually because, both medically and sensationally speaking, that is the supposed eventual goal of the fruits Genome project.

    Now, I pose a question to slashdot readers. I'm primarily a web application developer and don't really know how far the field of computer modelling has gone in terms of biological systems, so now that we've mapped all the genes, how much longer until we can create a system to mimic the human body closely enough to try our genetic experiements out digitally? Because until that point, I really don't see what good the Genome has done for us.

  • by Chiasmus_ ( 171285 ) on Friday June 23, 2000 @08:28AM (#979793) Journal
    You know, I'm not a big fan of oppression of minority groups - but I still can't feel entirely terrible about this.

    This technology will have to be tested on people before it can be used for the good of mankind. Now, in a perfect world, of course, I'd suggest some kind of "lottery" system where they picked a person at random and everyone wanted to volunteer.

    But, let's face it, that's not going to happen. Instead, the technology is created by the highest bidder, who tests it on the lowest bidder. In the words of King Missile, "That's reality. That's the way it is."

    Now, someone might say, "Aren't there any methods of learning that don't involve human/animal/vegetable testing?" To which I'd remind you that, as a group consisting largely of "computer people", we know better than anyone else that you learn twenty times more from your fuck-ups than from your successes.

    In conclusion, human testing is sometimes necessary, and we should force it upon the Amish.
  • The aplications of science like this are boundless. Many people are frightened of technology such as this evolving, but we must embrace it to learn from it.
  • Early next year you can start by gett ing your own genetic profile [cnn.com]. Mail in a few cells and see what you're made of.
  • by xscarecrowx ( 118632 ) on Friday June 23, 2000 @08:32AM (#979796)
    The diffrence between this and the moon is simple. It's more than just been there done that, we went to the moon proved it wasn't made of cheese after all, brought back (I believe) roughly 2000lbs of moon rock, there isn't a whole lot of new things we are going to learn. While the genome project has just started what we will be cappable of. This opens the doors for hundreds of new treatments for diseases, birth defects etc etc. Medical science is going to benifit an whole lot from this in the next 20 years. I can't wait!
  • Things like growing modified human clones (with, say, an eye in the back of the head) would never ever pass any kind of review board

    In the past, the traditional ways of circumventing review boards included:

    1. Mad scientists
    2. Fascist governments
    3. Bribery
    4. The certainty that someone would profit

    Fortunately, in this age of the internet, I don't think it's terribly unlikely that a bunch of random guys are going to get together, gather a bunch of genetic information, and build a genetic abomination solely for the sake of leveling their Everquest character.

    In conclusion, technology is good.
  • if its like any other sort of technological advance, well, if the hard work is done...ITS TIME TO SUE SOMEONE!
  • This announcement (assuming its accurate and the gene is actually mapped) just means that they're at the point where they've got a genetic Rosetta stone. It was a big job, it was important, but it isn't the final outcome. It's just a significant milestone.

    The next step will be determining the purpose of each part the genome. This is the act of translating the genetic Rosetta stone. This is a significant milestone. It still isn't the final outcome.

    Once this information is known it will be time to try and influence genetic makeup in a controlled and predictable manner, resulting in the potential for: new treatments for diseases; in utero or in ovum genetic modification; genetic enhancement; organ growth etc.
  • by Chiasmus_ ( 171285 ) on Friday June 23, 2000 @08:35AM (#979800) Journal
    I know I'm jumping the gun a lot here, since we can't do much more sophisticated things than cloning a sheep and curing cystic fibrosis in lung tissue that is not attached to an organism, but...

    It strikes me that genetics are a lot like source code, and that we've sort of reverse-engineered a template for writing this code.

    So the big question is: when they start coming up with genetic enhancements to make us smarter, stronger, and more fragrant, are they going to be packaged in such a way that we can't tell what they are without doing the whole reverse engineering process over again (i.e. MicroSoft Harry), or are the specs going to be put out for all to see, so that we can all create our own personalized monkey-men (i.e. GnuMonkeyMan)?

    I'm a little disturbed by my own post.
  • by ocelotbob ( 173602 ) <ocelot@ocelotbo b . org> on Friday June 23, 2000 @08:35AM (#979801) Homepage
    Start applying compression algorithms or various windowing sizes to figure out patterns inside of a gene, a chromosome, and even an individual. Get good cryptographers to look at it, see if they can find patterns. Have computer people look at it, see if we can find patterns. In short, look at the patterns, start inferring more information, experiment, compare with the genomes of other animals, have some fun with the genetic soup.

    This is a fun time to be alive, and I'd love to see if there are any interesting results if one were to gzip DNA. I'm sure there are all kinds of interesting thing you could learn from just that.

  • OOOHH!! I know!! Fight over the patent rights!
  • Allowing people to use "experimental" drugs is a good thing, as long as the people taking them understand the risks... it gives them treatment for things that they otherwise might not be able to afford or have ready access to.

    The anecdotes you provide suggest doing tests covertly, which is unconditionally a Bad Thing.

    But to be honest, it certainly isn't just the US government, nor just US companies. And it isn't done just on people of Central America, it's done on US citizens as well.

    Not too long ago there was a flap about radiation experiments done at the University of Rochester in NY (a number of years ago now...) on unknowing subjects.

    No need for US bashing... Personal accountability and individual rights are poorly understood and insufficiently protected or respected the world over.

  • But, unless we strive for a perfect world, how can we ever hope to get closer to having one?
  • by IdiotBoy ( 5883 ) on Friday June 23, 2000 @08:37AM (#979805)
    What we do next ought to be obvious. Corporations/organizations/institutions must get together and figure out how to use this ethically. Surely, if we can cure multiple sclerosis, can't we cure [your_least_favorite_skin_color_here]ness?

    I'd like to use this as a stepping stone to note that our genetic diversity provides a certain resiliancy to -unknown- attacks.

    Since I'm a geek, I'll compare it to a computer network. [Warning: I don't know what 'mapping a genome' really means, how much we understand of which genes do what and how they interact based on the mapping.] Suppose you run a computer network. You keep up to date on all the latest patches, you read bugtraq religiously and patch all the holes you can find in your systems. You're still going to miss something somewhere. Some malevolant force creates a 'sploit versus your favorite operating system which goes undetected for some period of time. In that time, the kiddies have compromised all of your systems, bringing down the whole enterprise.

    Obviously, you'd be in a better position if you used a more heterogeneous (even the word makes my analogy) network strategy. Having a system of like-configured boxes makes each box as strong as possible against KNOWN enemies, but makes the network less resiliant against UNKNOWN enemies.

    In case you're having trouble following the analogy, consider the human race =~ network and human being =~ individual system.

    Now the question becomes, "Who is going to want to forego protection against the known in order to protect the race against the unknown?" Imagine if computers were able to choose their own OS.. would any choose to be [insert your least favorite OS] as opposed to [insert your favorite OS], just for the good of the network, at significant personal risk?

  • The answer to "what will they do next?" is fairly obvious: they'll patent the human genome. Never mind the fact that it's laughably unpatentable; we all know that the USPTO is so screwed up that the patent will be granted, effectively freezing progress in this sector, potentially for decades.
    --
  • Merely mapping (which I don't think that they have, considering we don't even know when we stop mapping the human genome.. it's not like there is a big sign that says, "You have reached the end of the genome, thank you, now go home") doesn't achieve ANYTHING. At all, I wrote DNA analysis software to identify possible "interesting" strands as they went through the processor. The methods used to map DNA, if just stuck in there will contain A LOT of contamination and misreads, hence their so called complete map is one that would be analagous to that drawn of a third grader with a crayon. Granted, they are doing a significant amount of research and should be commended for it, but just mapping doesn't mean anything.
    The thing that I really have a problem with is that Celera just dumps all their gene reads into the patent office and gets rewarded the intellectual property for said read. This is complete crap - they did not discover anything that should be worthy of a patent. Maybe we should branch off a new patent office for this type of work. The read should be forced to be open and free to use after 3 years maximum, this will stop someone who figures out the gene for cancer, obesity, intelligence, whatever from forming a monopoly screwing us out of healthy, slender, really smart people.
    However, I know a lot of you think that this work would not be done if they didn't patent this work so they could sell it to pharmo's to make money. You are right, they should be able to have limited commercial rights to it. The ability to cure a plague upon humanity should be a non-commercial engagement.
    Just my overly long $0.02.

    nerdfarm.org [nerdfarm.org]
  • I doubt it. That would imply that most people are actually concerned about the moral imperative. It's like the A-bomb, lets make it, try it, then decide it's wrong.
  • You know, I'm not a big fan of oppression of minority groups - but I still can't feel entirely terrible about this.

    Minority? What the hell are you talking about? I'm not in a minority! Hint: There's a world ouside your country where you would be a minority.

    This technology will have to be tested on people before it can be used for the good of mankind.

    Don't give me your talk about "for the good of mankind". Say it straight: "so some hotshot unitedstatesian millionaire makes a buck from the genetic deformation of third world peasants".

    Instead, the technology is created by the highest bidder, who tests it on the lowest bidder. In the words of King Missile, "That's reality. That's the way it is."

    Yeah, that's so convenient for unitedstatesians on top of the food chain like you. Don't be surprised if the rest of the world has a different idea.

    I'd remind you that, as a group consisting largely of "computer people", we know better than anyone else that you learn twenty times more from your fuck-ups than from your successes.

    You're euphemising with "fuck-up". Why don't you say what you mean: "We learn twenty times more from making Guatemalan women bear deformed children."

    In conclusion, human testing is sometimes necessary, and we should force it upon the Amish.

    You end up sounding like the Japanese would have said of Koreans in WWII.

  • How long until we see the slogan "Engineering a Better Human"? Who decides what's better? What's the criteria for good and bad genes? What is freedom and what is insanity in the case of gene manipulation? This will be a cure for cancer, and a weapon that will kill millions.
  • Biros? (no, really... huh?)

    Is that another type of footwear? Not in my dictionary...
  • Who moderated this up? The only "guinea pigs" are the individuals who donated small tissue samples that are the source of the genes. If I recall correctly, these "guinea pigs" are some of the actual scientists involved, at least in the public effort.

    And could you provide links to support this "insightful" flaimbait?
  • Now, what precisely is our point of disagreement, since you call me a troll?
  • The project was originally expected to take 15 years. That was what? 5 years ago?

    Three months ago, I went to a seminar on Bioinformatics - and it was stated that the project would probably require another two years to complete. :) I love this field; six months ago qualifies as ancient history.

    Now, about that protein folding problem...
  • by maelstrom ( 638 ) on Friday June 23, 2000 @08:44AM (#979815) Homepage Journal
    I think our descendants will put this achievement in the same category as the Moon landing or splitting the atom.

    We'll finally have the script to our bodies. Whether you believe in God or Evolution or some combination thereof, this is a landmark event. For the first time, a species will have the ability to view and eventually change its own blueprint.

    My fondest hope is that our society will be able to catch up enough with technology, so we can deal with this the Right Way(tm). I think Gattaca had some very relevant messages, that need to be discussed as we move into this technology. We the public need to be very aware right now of what is happening with the patenting of genes. There is a great potential for abuse.

    I'm glad that both the public project and the private sector will be announcing this together. The Human Genome Project [ornl.gov] immediately publishes their data on every night. You can be sure that Celera [celera.com]'s downloads it every morning. It would be an affront to the scientists who did so much work in the public project if Celera tried to steal all the credit.

    Be sure to check out the Charlie Rose show this week on PBS. He has been running a week long special on all this. I highly recommend it.

  • by DG ( 989 ) on Friday June 23, 2000 @08:44AM (#979816) Homepage Journal
    (We'll ignore the thorny issue of genetics-as-IP for the moment)

    As I recall, large chunks (if not the majority) of our DNA is really junk information, stuff that doesn't really _do_ anything. Sorta like the bit-rot that accumulates on hard drives after a couple of years of use. That fragment over there used to be part of a tarball I deleted, that over there was part of my mail spool, and so on. Areas that once held information, but are now marked as "free blocks" and so unused.

    It wouldn't suprise me to find little chunks of "how to grow a tail" or "how to put bright blue pigment in your buttocks" in human DNA.

    So from the point of view of someone hoping to make money off the annotation process, you've got to hope you annotate something that's actually part of the program, instead of "how to grow gills and scales" or some such.

    That strikes me as a lottery, not a business model.

    BTW, can somebody in the know comment on how the annotation process works? How do you know what gene [foo] does without actually flipping it and watching the results? Do we have a good enough understanding of the inner workings of DNA that we could model it, and simulate flipping the bits?

  • The technology is not to blame for the uses to which it is put. As implied by your quoted "benevolent", the entities or organizations that perform tests on unknowing subjects are hardly laudable.

    The human genome project is a technological project of tremendous potential for both good and evil. Unlike the atom bomb, this could help fundamentally change the very basis of our global society for the better.

    While you can complain about abuses of the past, I think your efforts would be better spent trying to ensure that they don't happen again and to encourage that the technology is used for maximum benefit for all humankind.
  • Easy; the one from Celera. Why? Because the scientific effort didn't make any attempt to apply something like the GPL to their data. That means that Celera is ahead and always will be ahead because they can combine their privately generated data with the publically generated data to get a more complete picture. The result is the Celera will be able to make a big profit by selling data half of which was funded by government sources.

    A strong license might have been able to force Celera to release data that incorporated the publically funded results under less restrictive terms. Instead they can grab all that public effort, combine it with their own work (which is admittedly pretty impressive) and sell it back to people. It hardly seems fair.

  • And it isn't done just on people of Central America, it's done on US citizens as well.

    You're right on this. But you'll have to excuse me for concentrating first on the defense of those who have the least resources to defend themselves.

  • Next up, the field I'm prowd to be working in! Bioinfomatics, people!
    The nucleotide sequences don't mean anything unless you interpret them. That's where massive data analysis comes in. Protein sequences have to be isolated, the shape and folding of the proteins simulated and their interactions catalogued.
    Additionally, there is gene expression data to combine with genomic data - there is no good in knowing what a gene is unless you know how much protein is being made from it. Here comes in the cDNA microarrays which measure just that. (cDNA microarrays work by figuring out how much mRNA (the template for proteins) for a given gene is in a certain type of cell, and do this for 5000 or more genes at a time)
    With comprehensive parallelized databases of all the genes, with protein and expression data, we will be able to do much more with the genome than a bunch of letters.
  • by Tim ( 686 )
    It's odd to hear that *both* Celera and the HGP are announcing "completion" of the sequencing. Keep in mind that as recently as late last year, the HGP was loudly criticizing Celera for their reckless and largely PR-driven approach to human genome sequencing.

    This could suggest a couple of things, IMHO:

    1) Celera and the HGP have managed to reach some agreement on IP and the sharing of information between the two efforts, thus ending years of bickering, and providing a more complete map than either could accomplish alone (to date).

    or

    2) The HGP is racing (probably against the better judgement of its member scientists) to keep up with the steady flow of BS PR that comes out of Celera. For some reason (probably the cynic in me), I think this is the more likely case.

    I've never been a fan of Celera--I've read their published data on the fruit fly genome (declared "substantially complete" BTW), and was amused to see coverage gaps big enough to drive a few hundred genes through. This concerns me a lot--once we allow corporate interests to drive science, will we see a degradation in the quality of basic research like this?

  • I think structural genomics which is also being researched is provides useful information to complement the genome project. This is the 3D structural determination of protein domains based on the amino acid sequence of the protein. With a database of these structure-sequence relations, when a new gene is encountered, the the 3D structure can be inferred and from there drug design and all the other medical benefits people talk about are possible.
  • by Anonymous Coward on Friday June 23, 2000 @08:47AM (#979824)
    As someone doing his PhD research in bioinformatics and computational biology, I'm surprised that no one here knows that what both Celera and HGP are announcing is not the 100% complete, every base is sequenced, here's the whole thing on a 3.2 Gb disk for you. They're announcing that they've assembled most of what they have into a reasonable approximation to the true sequence, with substantial sequencing errors and misassemblies left to be worked out over the next few years. Think of it as having finally finished scanning the pages of the complete works of Shakespeare, and running a first pass OCR algorithm on it - you've got the data, you can see where the plays start and end, and even alot of information about acts and scenes, but alot of cleanup and closer examination is necessary before you post it to ebooks.org
  • I thought that the 2 maps were not going to be shared between the 2 groups - whole bunch of IP stuff in there etc..
  • The answer is obvious:

    Unleash our legion of genetically-enhanced mutant killers!

  • "Get good cryptographers to look at it, see if they can find patterns"

    ...find a pattern that rought translates:

    "Congradulations! You finally figured it out - signed, GOD"

    or

    "This code derived from original Andromeda strain [sqn.com] implanted Sol+14097, Copyright Andromeda Bioengineering, Galactic Diversification and Colonization Corporation, all rights reserved."

    ATATATATGGATATACTTATATGAACTCTCTCT
    TATATATACCTATATGAATATACTTGAGAGAGA
  • by scheme ( 19778 ) on Friday June 23, 2000 @08:52AM (#979832)

    So the HGP and Celera have managed to sequence the geonome of a single person. This doesn't really address the fact that there are variations on genetic sequences even those that code for important proteins. Some of these variations cause problems but others don't. Although HGP is attempting to sequence the geonome's of 4 different people in other to get this variation, this doesn't really capture the distributions across different ethnic groups. Getting that is problem that is even larger than sequencing a few geonomes.

    Another problem I see is that even if we are able to sequence the genetic code for all the proteins, what are we going to do with them. Identifying genetic diseases before they occur is all well and good but is it really that valuable if all we can tell people right now is that twenty years down the line you're going to get Hunington's disease or someother incurable ailment and die?

    The outlook for coming up with effective genetic therapies is pretty bleak. We haven't really been able to treat even the diseases that are purely genetic and are caused by a well defined mutation. With this sort of track record how are we going to do against diseases that are caused by multiple mutations or where different individuals with the disease have different mutations? And this isn't even considering diseases that are caused by interactions between interactions between the gene and environment/history of the individual or disease caused non-genetic inheritance.

    It seems like alot of people see genetics as a panacea for all human ills. However this overlooks the fact that the environment is just as important as genetics. In some respects, the attention that whole gene therapy is getting resembles the hype that surrounded radiation in the early 20th century when radiation was going to cure anything and everything.

  • by Borealis ( 84417 ) on Friday June 23, 2000 @08:53AM (#979834) Homepage
    The first step is to use the data to help us understand what makes us tick. Why does alzheimers make us vegetables, why doesn't our body regulate fat accumulation better, why does macular degeneration occur for some and not for others.

    Once we understand the workings of our bodies and how to repair them, we can greatly advance our treatment of virtually every ailment known to man (including old age). When you ask about the practical applications, I'm somewhat at a loss, there are far too many to list here.

    Cloning (in comparison) is a simplistic matter, it only involves trying to copy somebody's genetic matter.

    Review boards aside, this information will be used for good (hopefully predominately) and to further causes of greed or malevolence. To draw an analogy, for molecular biologists this is like having somebody dump the source code to the universe on your lap. We still have to wade through it all and figure out what it means, but we now have the friggin source (although obsfucated).
  • I'm going to bring up a class-action lawsuit against both companies, they have reverse engineered our DNA - this is clearly an infringment on our collective property, and the reverse engineering itself is denied by the DMCA.
  • Only part of the DNA is actual genes. Genes look 99% or more similar from one animal to another, and the major difference between e.g. a human and a mouse is in the other "garbage", outside of the genes.

    Also, not all genes are necessarily in use. One key to understanding which ones are "turned on" and which ones are not, might lie to understand that "garbage" outside of the genes.Compare to a software application; the genes are the data, while the stuff outside is the actual instructions which tell how to read that data.

    Celera is now about 1/3 on the way to sequencing the mouse genome. Being able to compare genomes from different animals might give us some further clues to understanding ourselves./P.

  • The real work will be turning the sequence into useful information. First what and where are the actual genes, then what proteins do the genes code for and what role the protein plays in metabolism or regulating other genes. Some idea of how much work needs to be done can be gathered from the fact that we don't even know how many genes there are - the most recent estimates for the total number of genes range from about 40,000 to 120,000. This process is called "annotating" and will take years.

    I just got back from a conference where there was some very, very interesting work on data assisted annotation efforts. The basic idea is that you can look at the actual proteins produced by an organism and work your way back to finding the genes that specified them. This kind of approach could make the annotation effort a lot easier and speed the whole process up a lot. Those of us who work with proteins for a living also find it funny as hell that after hearing DNA folks brag about how everything is really in the DNA, they may need our help to finish up their work. Of course it's also great that once they're done with the genome, our work can really get started.

  • Humanity's revolution for the next two decades to be feuled by bio-genetic discoveries, not by advances in computing power (not that one didn't catalyze the other)

    Actually, I think both will be still involved. Genes encode proteins which then work on other atoms/molecules (short form explanation). Until we can do molecular modeling on a macro scale (cell size and larger), any genemodding will be very difficult to test due to the several billion different compounds present in a biological higher life form.

    The computer power required for that sort of thing is still a few orders of magnitude away from present day with all but the most powerful (and expensive) supercomputers.
  • Given a sequence of aminoacids (which is exactly what this allows us to do), you can theortically predict what a protein or an enzyme will look like and how it will behave. We have only had slight success in modelling this on computers. My analogy is that it's as difficult as rolling 2 dice and predicting how they're going to land. Sure, if you know their starting position, and account for every physical force that is exerted on them until they come to rest on the table, then yes you can predict their behavior every time! That's a bad analogy, but it's a good way to describe how the slightest error in measuring the forces and location of stuff can throw the predicted results way off. Remember every electron counts at that scale! So if you build these models well enough, you can for example synthesise a new protein to be used as a drug, based on the knowledge that such-and-such a disease is caused by this or that problem within a cell. ie if you know what the problem is, you can mathematically crunch with brute force until you find a model to fix it.
  • Legislation can be passed to prevent this sort of BSD-ish corporate cannibalization. Whether or not Celera invested millions into their research is irrelevant in the court of public opinion, where some enterprising senator will likely spin the issue as 'selling humanity' and nail Celera's more nefarious profit motives to the wall.

    It's too easy not to do it (start up a backlash against patenting parts of people, as it were). The religious right will be all over it like a rash -- for once I happen to be pleased that they're a force.

    Venter is a great guy, and an engaging public speaker, but he has many reasons to be bitter towards the established academic community of molecular genetics. And that's why I don't trust Celera to resist compromising Venter's stated principles in pursuit of profits.
  • Actually this area has already been mapped. There is a small solar system which exists in a small SEP field (S.E.P. -- somebody elses problem) in which there are two planets orbiting a very improbable sun. The first planet is where socks escape to through a wormhole in the tumble cycle of a dryer. The second planet is where partially used ballpoint pens escape to. After the discovery of this solar system, the president of the universe quickly disregarded the discovery as a fabrication of the media. Ironicly, he also began domineering the market in used pen and sock puppet sales.

    This post stolen^H^H^H^H^H^Hinspired by Douglas Adams
  • The protein folding problem is not a problem. It merely awaits the ineveitable exponential growth of computing power. In the meantime, this might be a more useful problem for a distributed computing organization, rather than reading secret messages, looking for signals from little green men, or factoring large semi-prime numbers.
  • by rgmoore ( 133276 ) <glandauer@charter.net> on Friday June 23, 2000 @09:27AM (#979862) Homepage

    Knowing the amino acid sequences is a big key to being able to figure out how things work. Some examples:

    • You want to know what part of the genome makes us uniquely human rather than, say, a mouse. You will soon be able to compare the whole human genome to the whole mouse genome (which will be out in a couple of years) and see where they're similar and where they're different.
    • You want to know what things are really important for making organisms tick at a basic level. You can compare the whole genome of humans, mice, yeast, bacteria, etc. and find what genes in all of them are very similar. If it's close to the same in humans and bacteria, chances are it's really, really important.
    • You find a protein that's implicated in some disease or other. You correlate data generated from the unknown protein with the sequences for all human proteins to identify it. There's an excellent chance that you'll be able to figure out what it does by comparing it to known genes in other organisms.
    • You don't know what the protein above does. You can do experiments to see which other proteins it associates with (there are several ways of doing this) and that will often give you excellent information about what it does.
    • Coming soon You have identified a protein but can't figure out what it does. Using its sequence, you will soon be able to predict its 3-D structure, which can give you clues about what it does.

  • Easy; the one from Celera. Why? Because the scientific effort didn't make any attempt to apply something like the GPL to their data. That means that Celera is ahead and always will be ahead because they can combine their privately generated data with the publically generated data to get a more complete picture. The result is the Celera will be able to make a big profit by selling data half of which was funded by government sources.

    Actually, the US government is forcing Celera to make public any information they get on the human genome, within 24 hours of that information's discovery. The same applies to any other private firm that is working on the Human Genome Project. (I remember this because I was watching Celera stock back when it was $250 a share, and after this announcement was made, the stock dropped down to $80 a share.) This is one of the smarter moves the Clinton Administration ever pulled, if you ask me. The human genome is too important to keep secret or proprietary; and Celera still keeps its patents on genetic research techniques, which means the company can still profit. The information itself, however, is kept public.


    The Second Amendment Sisters [sas-aim.org]

  • Another problem I see is that even if we are able to sequence the genetic code for all the proteins, what are we going to do with them. Identifying genetic diseases before they occur is all well and good but is it really that valuable if all we can tell people right now is that twenty years down the line you're going to get Hunington's disease or someother incurable ailment and die?

    What you have to understand is that this is really very basic research. Just knowing the sequences alone is of comparatively little direct value. The real value comes from the fact that this will make all kinds of biological research tons easier. Knowing the sequences, for instance, makes it much easier to identify an "unknown" protein in minute quantities, which is critical to a huge number of experiments. The genome is basically a low level building block for generations of future biologists and medical researchers.


  • This page has been intentionally left blank.


    k.
    --
    "In spite of everything, I still believe that people
    are really good at heart." - Anne Frank
  • "Estadounidense" is the term used, which
    does transliterate into "unitedstatesian" or,
    if you're being anal, "statesunitedian."


    There's no reason, other than being a politically-
    minded wanker like Estanislao, not to use
    "American" -- much like the push to use "Negro"
    instead of "Black" in the 1970s, it's an attempt
    to work sympathetic magic: calling a knife a
    spoon will somehow transform it into one.


    You'll note "Negro" today is pretty frigging
    insulting to your average black person.


    Estanislao, of course, is a La Raza zealot, by
    whose standards people of South American (not
    Central American) descent are at least as equally
    scummy and repellent as the nasty gringos.


    The southern U.S. doesn't have a monopoly on
    poisonous racism. Hell, it's arguably a lot
    better off than large parts of Central and
    South America in that respect.



    gomi
    colombian dad, ecuadoran mom, U.S. passports all around

  • Use this knowledge of genetics to clone an army of Storm Troopers to attack Naboo, Tatooine and Alderon. Announce that you're trying to stop the Trade Federation in the Senate, but everything is so bogged down by beurocracy that nothing can get done. Call for the Senate to be disbanded, then get appointed Emperor. Kill Shmi and make it look like Obi-Wan was responsible. Turn Anakin to the Dark Side.

    Oh, you meant here on Earth, in the present. Oops.

    Damn I'm bored. ;-P

    --

  • > It wouldn't suprise me to find little chunks of
    > "how to grow a tail" or "how to put bright blue
    > pigment in your buttocks" in human DNA.

    Blue buttocks - oh hell yes! I could change my name to 'Smurf-Butt'. Most excellent.

    Even better - it's time to haul out those interesting science fiction books of yesteryear and find out what other cool ideas we can mine, such as:

    1) Distribute the function of the heart throughout the body in smaller 'modules'. Shot in the chest? Not as big a worry...

    2) Faster healing

    3) Ability to regrow lost limbs

    4) Better senses

    5) Gills for the water-freaks out there. Hell, that would truely be awesome. Guess what - lots more usable living space on the planet just opened up - it's a little wet, but that's no longer a concern, is it? LET my castle sink into the swamp! (but NO SINGING)

    6) Harder bones

    7) Built-in smog/cigarette smoke filters - or filters for anything toxic. Same thing for what we ingest - e. coli & other things filtered out - lead contamination filtered. Lots of possibilities here.

    8) Ability to consciously control the melanin levels in your skin - lighten or tan right away!

    9) TRULY change the colour of your hair and eyes.

    10) Control hair growth patterns - want JUST a mustache, and only where you want it? No problemo. The final solution to shaving. Nice.

    11) Grow your hair faster - or slower.

    12) Body sculpting - fat loss, muscle building, etc. Of course.

    13) Height/weight adjustment

    14) Change the body so we metabolize *all* food - never go to the bathroom again! Time to change the exits.

    15) Natural body/breath odor eaters...I remember a novel where a artificially-created 'pleasure' female was made so that it smelled like flowers when she farted. Heh. Good planning.

    16) Stronger fingernails.

    17) Better skin - better at resisting cold, heat, pressure, pain, etc.

    18) Upgrade the information processing capabilities - make the brain work faster, make the eyes/brain bit faster so you can see more 'frames per second'. Better hearing range - have better hearing than animals! Not sure how much that might be desirable, but you'd get used to it. I remember another novel ('Telempath', I think, by Spider Robinson), where a madman releases a chemical/virus/whatever that gives humans a sense of smell equivalent or superior to dogs - most people go insane from sensory overload, and society is forever changed for those who survive. Interesting read.

    19) Okay, I want cool eyes like cats. Those just look gnarly. *meow*

    20) The above-mentioned tail could be quite handy! Good for picking up chicks, I bet.

    21) Fangs. 'nuff said.

    22) Claws. Sure. More like Spiderman 2099, less like Wolverine

    23) Hey, speaking of Spidey - how'bout natural webshooters? Nice if you fall off a building or something.

    24) Better control over vocal chords - everyone becomes a fantastic singer - well, everyone has the EQUIPMENT. Still gotta get some training.

    25) Total control over reproduction - sex without sperm production and egg creation.

    26) Colour me like a zebra! Or not. Maybe more like a white tiger.

    27) Hey - maybe I could look like one of those dancers from Cats! THAT would RAWK.

    28) Read another book where they re-engineer soldiers - harden the skin, better eyesight, CNS (central nervous system) implants for access to many things. Also made the penis & scrotum 'retractible'. Okay, weird, but I'd probably opt for that.

    29) hey, let's make those fangs optionally poisonous while we're at it.

    30) Tentacles! With suckers..."Hi, my name is Cala. Last name Mari."

    31) Feathers. Or scales. Leaves? Hmm. Great camouflage possibilities here...

    32) Ohhh...poisonous spines - like a porcupine! A whole new age in warfare...

    33) Maybe 'Skunk Power'!

    34) Okay, now wings would be interesting - even if they're just decorative. Perhaps visions of 'Angels' in the past were just visions of the future! Think about it...you could _really_ screw with the religious folks here...

    35) Everyone has total recall! And I'm not talking about that bad Arnold movie, either...

    36) Radiation-proof - good for interplanetary travel. Put your DNA in constant 'Diagnostic Mode' - any damage done is immediately corrected.

    37) Abilities associated with idiot-savante's - lightning calculation abilities, etc.

    38) Noone is ever tone-deaf. Ever.

    39) Everyone hates country music. And disco.

    40) Control over metabolizing alcohol - no more drunk driving with 'InstaSober(tm) Genes from RonCo'!

    41) Control over sneezing, hiccupping, vomiting, etc.

    42) Control your blood sugar. No more roadrage! No more Diabetes.

    43) Adrenaline control. Caffeine industry is now gone. Nice knowin' ya, Starbucks. Same for the rest of the drug industries. Columbia becomes dirt-poor again. The drug cartels start investing heavily in Celera. Celera HQ is moved to Bogata.

    44) No more need for computer-generated creatures in future science fiction movies. Actors can control their own forms and voices! Pixar and ILM go bankrupt.

    45) Now that everyone is so smart, the world realizes that open source software is the only way to go! The Penguin enjoys new-found popularity at zoos.

    46) Mermaids become reality! Mermen, too (Aquaman!)

    47) Everyone now has perfect balance and coordination - sales of inline skates, surfboards, and other such products skyrocket.

    48) Telco's are pressured by law to provide fiber-optic OC48 speed access to each computer - 56K modems are just too slow for the 'brain-enhanced' public of the modern era. People can read faster than 56K now!

    49) 3D chess replaces regular chess in all major tournaments. Regular chess is just too easy - commonly played only in preschool.

    50) Nictitating membranes. Oh yeah.

    51) And Vulcan ears, too!

    52) Women become much happier with new 'Nimble-Tongue'(tm) Genes for men. :)

    53) the N.O.W. Genetic Research Centre funds 'Vaginal Teeth' genes...ouch!

    54) Basketball baskets are quadrupled in height. Football fields are much bigger. Baseball bats are made out of much stronger materials (as are the baseballs, footballs, and other sports equipment).

    55) Speed limits are abolished - everyone has reaction times sufficient to make them redundant. Traffic jams are mostly a thing of the past due to this, and transportation flows much easier.

    56) Since people are now smarter, mass transit & renewable energy are now in much higher demand. Pollution is demanded to be reduced, plus it's easier for the smarter engineers and inventors to figure out how to do so.

    57) Wars are ended. Religions are abandoned. The Taco Time 'Crisp Burrito' is finally given the praise it so richly deserves. Telecommuting changes the face of the world when it becomes the norm. Children grow up with parents as they're also educated remotely in the same dwelling where their parents work.

    58) Life is so good, the 10-hour work week becomes feasible.

    59) With all the new senses humans have, art and literature, movies and music, indeed ALL creative endeavours, reach new heights, putting the classical arts to shame.

    60) the new 'SmartHuman' (Homo Genius?) recognizes 'Battlestar Galactica' for the brilliant show it really was. And Pops Racer finally figures out how to put a friggin' LOCK on the trunk of the Mach 5. No more stowaways. Spridle and ChimChim can now increase the sugar in their bloodstream anyway, so there's no need to try freaky plans to get candy.

    61) the ISA bus and all legacy devices that attach to it, are _finally_ dropped from computers.

    Okay, so the last one is a stretch. *shrug*
  • Here comes in the cDNA microarrays which measure just that. (cDNA microarrays work by figuring out how much mRNA (the template for proteins) for a given gene is in a certain type of cell, and do this for 5000 or more genes at a time)

    The problem with the genechips (and IIRC they normally look at mRNA, not cDNA) is that there's not that strong of a relationship between transcriptional level and translational level. If you really want to know about levels of protein expression (and more importantly, differences in level of expression) you're going to have to look at the proteins themselves. Good thing that's what pays my bills. Of course then you have to realize that the level of protein expression doesn't necessarily equate with protein activity and you have to look at post-translational modifications ...

  • I have a question, pardon me if this is somewhat stupid, but in everything I've read about the HGP, I've never seen it mentioned.

    Whose DNA have they sequenced? Isn't everyone's somewhat unique? How do they take an "average" person's DNA, considering all of us have something unique, and/or some type of mutation in our genome. Don't get me wrong, I'm in total support of the HGP, I think it'll revolutionize medicine. I'm just curious as to what sampling methods they employ.


    ---

  • Perhaps the company you're thinking of is "DoubleTwist," which issued inflated press releases about having "analyzed" the genome. That caught the fancy of the press; here are two articles about it:

    Genome 'Dark Horse' Comes to the Fore [bbc.co.uk] (BBC, 8 May 00)
    Dot-Comming the Genome Race [wired.com] Wired, 8 May 00

    For more, you can see our Biotech page [tecsoc.org].

    A. Keiper
    The Center for the Study of Technology and Society [tecsoc.org]
    Washington, D.C.

  • So the HGP and Celera have managed to sequence the geonome of a single person. This doesn't really address the fact that there are variations on genetic sequences even those that code for important proteins. Some of these variations cause problems but others don't.

    Absolutely. Of course, to a large extent finding those variations is what genetecists have been doing for nearly a century. There are massive public and private efforts to scale up those efforts to make use of the genome data. See the SNP Consortium [cshl.org] for the most visible project. (Nitpick: I thnk Celera is sequencing multiple individuals.)

    The outlook for coming up with effective genetic therapies is pretty bleak. We haven't really been able to treat even the diseases that are purely genetic and are caused by a well defined mutation.

    I think you're calling the glass half-empty. My impression (somewhat unininformed - I work in genetics, not therapy) is that we're one or two breakthroughs away from being able to fix all sorts of things. Remember that DNA is DNA, and when successful delivery methods are developed, they'll most likely broadly applicable.

  • Whose DNA have they sequenced? Isn't everyone's somewhat unique? How do they take an "average" person's DNA, considering all of us have something unique, and/or some type of mutation in our genome. Don't get me wrong, I'm in total support of the HGP, I think it'll revolutionize medicine. I'm just curious as to what sampling methods they employ

    My understanding is that each gene in any human codes for a specific protein. For example, in the case of albinos, a gene that would normally code for the protien which causes skin pigmentation is missing or damaged. Apparently, every human follows the same "template": even though you might be able to roll your tongue into a "taco" and I can't, the protiens that create those muscle structures are coded for on the same gene.

    So, this "mapping" isn't exactly the sequencing of any person's DNA - they're just figuring out which protiens go to which genes (or gene clusters). It's a little deceptive, because when it comes down to it, they have no idea what most of the protiens actually do.
  • You're right - the question of the completeness of this 'draft' is somewhat unclear, but the press conferences on Monday should probably make things plainer. By "complete," we can safely presume they mean Celera's technique (which involves just a single person's genome) and the HGP's technique (several people's genes) can, combined, give us a certain arbitrary amount of the genome with a certain arbitrary amount of confidence.

    A the head of Celera himself said in recent Congressional testimony [house.gov], "There is no example of the results of any genome sequence project being published in the scientific literature prior to meeting the established quality, order and completeness standards. It would be poor science policy and a terrible precedent for the young genomics field." (My emphasis.)

    Of course, there aren't all that many published genomes altogether, are there? Those established standards for quality, order and compelteness are arbitrary, and peer review is sort of an odd process in a case that has seen so much public political ballyhooing. With the fruit fly genome, several minor errors were discovered and corrected - but remember that even very high accuracy (say, 99.5% accuracy) can mean many thousands of errors in a database this vast.

    So the next few years will be spent tidying up and cleaning up the data. But the key areas will be ascertained first, and those will get the most attention. And then - even as we speak - people will be busy annotating, and trying to find correspondences between gene sequences and phenotype - that's the huge task of figuring out just what this vast porridge of G, C, A and T means.

    For more, see our Biotech page [tecsoc.org].

    A. Keiper
    The Center for the Study of Technology and Society [tecsoc.org]
    Washington, D.C.

  • What we'll do when the human genome is completely mapped is being discussed almost daily among scientists. The post-genome era has become a big buzzword.

    One very convincing idea goes like this:
    - you have a problem that you'd like to tackle
    - analyze sequence data in lioght of your problem
    - filter out interesting trends/data points
    - develop a high-throughput assay to test for what the sequence data implies
    - analyze test data

    In other words, start on the computer, end on the computer, work in the lab in between. Sort of like what we do with literature already. You can, of course, compare the genome and related sequence data to literature anyway. It simply has be be read and understood. (No that we know a lot about the latter activity, but that's another story.)

    At a recent event I attended, an intersting example was given by Dr. Wei Hu, formerly of Human Genome Sciences, Inc.:
    They were interested in prostate cancer and therefore looked at ESTs (expressed sequence tags) from tissue samples of various stages of prostate cancer, as well as several other unrelated tissue samples as controls. The analysis simply consisted of looking for sequence tags that consistently turn up in prostate cancer, but not elsewhere. Half a dozen or so sequences were found and most proved to be known markers for prostate tissue, especially cancerous prostate tissue, but one or two were new. This all was only a few hour's work.

    Further research might then entail chasing these new markers, perhaps developing a simple and cheap assay for them, and voila, a new test for early stage prostate cancer. In practice this is of course not nearly as easy as it sounds, but you get the idea.

    With the complete human genome available, one would of course compare the sequence tags against the genome to find where they are, with what other regions they are asociated, what gene they come from, etc. This would dramatically increase the information content of the simple exeperiment that was done and described.

    The upshot IMHO is that biologists will dig much less in the dark, at least as far as sequence information goes. Checking the genome and other sequence databases will be just as mandatory and routine as a trip to the library is today. This in turn means that biologist will have to become much more computer-savvy, or that biologists and computer geeks need to develop closer ties.

    One thing to keep in mind, though, is that the upcoming announcement is only for the mapping of the human genome, i.e. known markers will be placed along the genome in more or less regular intervals. This amounts to a lowres image plus many (most?) parts of a highres one. The actual full genome sequence is still a ways off as gaps need to be closed in difficult regions and other boring cleanup work needs to be done.
  • This whole little thread is a bit off-topic, and I'm not sure what the reasoning behind moderating it up was, but while we're at it, why not post some evidence about your accusations? I haven't heard anything about scientists or drug companies experimenting indigenous peoples of third world coutries in modern, post-civil rights times. How about giving us some links to back yourself up? Anything that was done in the 80s or 90s?


    ______
    "Blazing down the road, el camino..." - Ween
  • Ahh, so they know that X protein is produced by a gene at Y location. But what effect X has on the human body, if any, is completely unknown at this time.

    So next, do they create mice with that gene knocked out and see what's wrong with them?

    I guess my own analogy for this would be that now they know where all the light switches are in a vast room of indicator lights. They know that switch A1 turns on and off light 2X, but they don't know what 2X indicates or affects.
    ---
  • by Otto ( 17870 ) on Friday June 23, 2000 @11:18AM (#979914) Homepage Journal
    I hereby declare my own genetic code open to the public. Anyone may use, modify, and distribute any base pair sequences that are part of me.

    Interested parties may obtain samples by sending cute women to collect them. Due to restrictions imposed by nature, and the fact that I hate needles, samples may only be collected in halves, through all-natural means. Putting these sample halves back together again is your own problem.

    (Well, I thought it was funny...)

    ---
  • IBM has already decided to throw a massive ammount of CPU power at protein folding. The supercomputer will be named Blue Gene (no, I'm not joking, I wish I was).

    -B
  • Here's a scenario I'm imagining: Joe Blow has insurance (through his job, say) and goes for a checkup, which includes some genetic screening. The test reveals a good chance of getting some condition that will be expensive to treat.

    Later, Joe quits his job to go freelance, say, and has to buy his own insurance. Since the results of the earlier test are part of his record, no insurance company will take him, except at exorbitant rates which he can't afford.

    I don't see that as a chicken and egg scenario.

  • This project is probably equal or greater in scale to the Manhattan project in it's potential effect on humanity. For the next 50 years, we're going to be worrying how bio-genetics will be misused while reaping the benifits of a new revolutionary technology. I wonder what will be the equivelant of "duck and cover"? Hold your breath for as long as you can?

    Sure, having the human genome completely mapped will help devise treatment for illnesses caused by genetic irregularity (such as Sickle-cell anemia). But genes are only one of five causes of disease:

    • Malnutrition - lack of vitamin C causes scurvy
    • Germs - the plague, smallpox, and malaria
    • Genetics - i.e. Sickle-cell anemia
    • Toxins - lead poisoning, heart disease, some cancers
    • The Mind

    Having the Human Genome to work with will allow researchers to develop treatments/cures to many diseases, but at what cost? At the dawn of the nuclear age, the power of the atom was seen as the solution for all the problems the world faced. Fifty five years later, we are stuck cleaning up the messy legacy that nobody wants. Today's genetic scientists will likely use the genome to devise genetic solutions for health problems, when no genetic problems exist in the first place. What happens when some scientist creates a genetic therapy treatment for Scurvy, when the only "treatment" needed was to pick up an orange at the store?

    see this page [buildfreedom.com] for some provacative ideas on being healthy...

  • Please note that "unitedstatesian" could also refer to the "United States of Mexico", the official name of our southern neighbor. Please do not confuse the readers.

    :)

    -Dean
  • by Anonymous Coward
    After genomics, the science of genomes, the next level will be *proteomics*, the study of total the protein content of a life-form, protein interactions, and their chemistry. I have seen Craig Venter speak twice this year and both times he has indicated that proteomics is where his true interests lie. Venter started out studying proteins. If you want to understand anything in life, from what makes an arm shaped like an arm, to what makes a schizophrenic, to how a virus infects you, you have to understand proteins. Proteins catalyze almost all of the chemistry that goes on inside an organism. Studying them is quite difficult (it's the subject of my dissertation), but the rewards are boundless. (Side note: RNA can also perform chemistry, e.g. ribozymes) Take AIDS. There's a protein called "HIV protease". Chemists determined the precise 3-D structure of it, modeled it on a computer, and then screened a database of compounds to see what structures would "dock" into the business end of this protein and jam up it's ability to perform it's role in HIV. They came up with candidates, made a library of variations and viola! they made one of the first anti-viral drugs. Take superoxide dismutase. (SOD). This enzyme/protein helps scavenge toxic superoxide from your cells keeping them from getting damed by metabolism and such. If you take the gene for this protein and introduce it into a fly via a virus, you can double the life span of the fly! There is no limit to the impact of all of this, but the real exciting stuff is not the genes, but the proteins that they encode. And that is why Venter is working with PE Biosystems to make new machines that are suited for studying things like protein expression patterns. It's a wild time to be a biotechnologist. I feel like a physicist at Los Alamos. I plan to celebrate on Monday, but I feel like I'm celebrating the end of the world. O'Biquody
  • And in some ways, the computer revolution if fueled by arguably the greatest acheivement of the 20th century: Mass production of electricity.

    It's like passing the baton. Yes, they'll go hand in hand, but in twenty years, the computers will just be a tool, and not recognized as part of the achievement itself...
  • Malnutrition - lack of vitamin C causes scurvy

    Bio-genetics: Crops that produce triple yield. But will we still hold back distributing them to the people who need them? (We collectively as humans, all groups reponsible for withholding food)

    Germs - the plague, smallpox, and malaria

    Know thine enemy. With better understanding of these bacteria and viruses, we have the power to be more efficient killers of other species. Some of those species SHOULD be eradicated. (or at least, sealed away in little jars deep in Atlanta)We're human, we're species killers, we're good at it. We just have to hone our specicidal instincts to cull very VERY carefully. I want to see smallpox, malaria, AIDS,etc, DEAD. GONE. ERADICATED FROM THE PLANET. No fucking monuments. That's speciecide. We just have to be DAMN careful we're not destroying the ecosphere, just altering it. The only other alternative is to leave all the bacteria and viruses happily behind and leave the planet. Not likely in the near future...

    Genetics - i.e. Sickle-cell anemia

    Bingo. Look for advances at a pharmacy near you.

    Toxins - lead poisoning, heart disease, some cancers

    Some bacteria can be engineered to control environmental toxins, but I don't see this as being significant either. We might be able to treat OUR resistance to toxin, but bye bye biosphere.

    The Mind

    Big one there. We're a LONG LONG LONG way off.

    Hopefully we can genetically engineer the tolmarese extenders so I can live a few hundred years to see that revolution start....
  • I think you're calling the glass half-empty. My impression (somewhat unininformed - I work in genetics, not therapy) is that we're one or two breakthroughs away from being able to fix all sorts of things. Remember that DNA is DNA, and when successful delivery methods are developed, they'll most likely broadly applicable.

    My point is more that right now many people have hyped up DNA and knowing the genetic sequence will not give us a magic bullet since developmental and environmental factors seem to be just as important.

    My problems with a lot of what is being said is that DNA does not solely determine what happens. Have been non-genetic mechanisms that can also affect expression of genes and the proteins that arise from these genes. For example, a few years ago there was a journal article about how heat shock proteins in yeast (hsp70, I think but I could be wrong) would change if the yeast were stressed and how these changes were passed onto offspring. It's possible that genetic expression could be dependent on whether the sequence is expressed or not. Think of something like the lac operon but where the promotor is revealed only if the dna is methylated or something. If the genetic system we are trying to change works like this then changing the DNA alone is not enough.

    I suggest you read an article called The Dream of the Human Geonome by R.C. Lewontin(New York Review of Books, vol 39, no 10, May 28, 1992) to get a clearer picture about where I'm coming from. Some of his examples aren't that great but he raises some important points.

    BTW, I've taken only one genetics class a year ago so my examples may be wrong here or there.

  • After WWII it was decided that we needed to know far more about the makeup of living organisms than we knew then. I forget who the players were, but the decision was to take a simple bacterium, Escherichia coli, and find out all about it that was doable with the methods available then. This was the first truly large scale biological research effort and it ammassed a ton of data. As a result we have an extremely well understood lab organism which enabled us to revolutionize genetics.

    I agree that our understanding E. Coli has led to a great deal of advances. My problem is that a lot of the researchers have made DNA the end all and be all of life with some lip service being paid to environmental and developmental factors. Sure the HGP will bring a lot of advances, but will it bring cures for all inheritable diseases? Not necessarily, if these diseases depend on environmental or developmental factors. But when leading molecular biologists start saying things like given a complete DNA sequence and a fast enough computer, he could determine the organism totally, I think we have problems.

    My reply to the message above yours has citation that does a lot better job of illustrating some of my concerns.

  • Well, it's both, to the effect that it would take a few lines of perl (maybe you could do it with tr?) to convert from one to the other. Three pairs of nucleic acids code for one amino acid. And arguably, the "amino acid sequence" is the one that people would be more concerned with. Once you have that, who cares what the nucleic acids were?

    Actually, the translation can get a bit tricky, and there are reasons to stick with the DNA form rather than translating. With an unanotated DNA sequence you have to translate in all six relevant frames in order to be sure to get the one frame that's actually used. Even worse, with eukaryotic DNA you have to worry about the whole intron-exon structure. That's a little bit tough to handle with tr, or even a short perl script. The software I'm used to using will auto-translate in all frames, though, so I'm used to thinking of DNA and protein sequences as essentially the same thing.

    On a deeper note, there are some interesting things that you can spot by looking at the untranslated DNA sequences. For homology matching, for instance, you can spot mutations that leave the AA sequence unchanged. More interestingly, you can look at things like codon bias. Codon bias is really interesting. There are, of course, multiple DNA triplets that code for the same amino acid. The more heavily translated a protein is, though, the more it tends to use only one of the available triplets to code for each amino acid. That means that given the DNA sequence for a protein you can make a reasonably accurate prediction of its abundance in the cell. Try that from the amino acid sequence alone!

  • My point is more that right now many people have hyped up DNA and knowing the genetic sequence will not give us a magic bullet since developmental and environmental factors seem to be just as important.

    We're talking past each other, I think. You're right that DNA sequence doesn't 100% determine fate. But it does entirely account for certain conditions (Tay-Sachs, ADA) and it accounts for a large portion of the variation in many other health issues. Furthermore, to the degree that outside factors are important, greater knowledge of biological pathways will be extremely useful to pin down what those factors are and how they exert their effect.

    I suggest you read an article called The Dream of the Human Geonome by R.C. Lewontin(New York Review of Books, vol 39, no 10, May 28, 1992) to get a clearer picture about where I'm coming from.

    1992?!? Molecular biologists recognize two historical periods: the last year and everything else. You might as well tell me to read Pliny!

    Seriously, I read that years ago. You've got to read Lewontin in the context of his interminable public dispute with Stephen J. Gould. He's arguing against Gould's views on evolution, or a caricature thereof, not against anything that real-life human genetecists actually believe.

  • Identifying genetic diseases before they occur is all well and good but is it really that valuable if all we can tell people right now is that twenty years down the line you're going to get Hunington's disease or someother incurable ailment and die?

    The outlook for coming up with effective genetic therapies is pretty bleak. We haven't really been able to treat even the diseases that are purely genetic and are caused by a well defined mutation.


    That's about to change, big time!

    A hack using a combination of DNA and RNA has been constructed, which zeros in on a particular site on the cell's DNA, clamps on hard (using the RNA portion of the composite molecule), and prompts the cell to make exactly the desired edit (apparently by convincing the DNA repair enzymes that there's work to do).

    Not only that, but if you just put the DNA/RNA hacking molecule OUTSIDE the cell and temporarily tweak one parameter (pressure, I think it was), the cell takes up the molecule and transports it to the nucleus.

    So you can edit cultured cells in the desired manner, then implant them in the patient. If the disease is, say, an enzyme deficiency, you're done.

    Edit some stem cells and inject them, and they'll replace or gradually convert whole organs.

    If you need to work on a lot of cells in some tissue of the patient at once, you might be able to just shoot him up with this stuff until his cells are swimming in it, then pop him into a hyperbaric chamber to get the cells to take it up. If that doesn't work, try using viral envelopes as nanotech syringes.

    There's LOTS of possibilities. The revolution is almost upon us.
  • Once you've got one sample, you need to check it against others to find the variations (especially: to find the oddball stuff unique to the baseline).

    But that's a LOT easier once you've got the baseline established. You can hybridize the baseline DNA strands with strands from the new target to zero in on the differences.

    Meanwhile, you can work with the baseline to identify the location and function of each gene. You start examining the variants as they become available.
  • Seriously, I read that years ago. You've got to read Lewontin in the context of his interminable public dispute with Stephen J. Gould. He's arguing against Gould's views on evolution, or a caricature thereof, not against anything that real-life human genetecists actually believe.

    I didn't realize that Lewontin had a ongoing feud with Gould. You're right that I'm not denying that certain diseases are entirely due to genetic mutations. However, I'm pessimistic about the development of a viable genetic treatment in the next 10-20 years. The problems with reliably injecting genetic materials in somatic cells in vivo seems pretty difficult at the moment. I'm sure you know about problems in getting genetic cells into germ line cells. It just seems like right now, getting genes in 10-20% of the somatic cells you are targeting seems to be difficult and won't be solved anytime soon. On the whole, I'm hopely pessimistic about the promise of gene therapy in treating some of the identified genetic disorders. I certainly don't believe some of the more wild speculations that others on this forum have made will come about anytime soon.

    However, I do agree with you that sequencing the geonome will allow people to identify gene location much more quickly and will allow discoveries that we can't forsee right now.

  • Whose DNA have they sequenced?

    There was a big article about this in a recent issue of "The New Yorker", the whole Celera vs. HGP spat. According to rumor reported in the magazine, Celera's DNA is supposed to be J. Craig Venter's. It was neither confirmed nor denied.

    Venter has some valid reasons to be pissed at the HGP. The people in charge told him that his fast methods wouldn't work. Of course, as soon as he started Celera using the methods, HGP switched to them as well. But, the whole idea of being able to patent gene sequences is so deeply offensive that it should be outlawed.

  • "Another problem I see is that even if we are able to sequence the genetic code for all the proteins, what are we going to do with them. Identifying genetic diseases before they occur is all well and good but is it really that valuable if all we can tell people right now is that twenty years down the line you're going to get Hunington's disease or someother incurable ailment and die? "

    This might be slightly offtopic, but just very recently (no more than a day or two ago) I came across an article concerning a new drug that substantially delayed the development of Huntingdon's Disease in a mouse model. Unfortunately, I can't seem to remember where I last saw it. Of course, this particular candidate may or may not make it to human clinical trials, but regardless, I'll bet a knowledge of Huntingdon genetics was used to develop that mouse model.

    "The outlook for coming up with effective genetic therapies is pretty bleak. We haven't really been able to treat even the diseases that are purely genetic and are caused by a well defined mutation. With this sort of track record how are we going to do against diseases that are caused by multiple mutations or where different individuals with the disease have different mutations? And this isn't even considering diseases that are caused by interactions between interactions between the gene and environment/history of the individual or disease caused non-genetic inheritance."

    Maybe we can't patch busted DNA, but what we do know has already been a great boon to the traditional way that treatments are developed. A great many phamaceuticals were developed by nearly blindly trying out lots of different substances--for instance, finding antibiotics by throwing stuff onto a plate and seeing if it inhibits bacterial growth.

    Being able to find and manipulate a gene allows us to apply that same sort of approach, by developing animal models or in-vitro systems that allow rapid assaying of potential treatments. So instead of throwing extracts of eye of newt and toe of frog onto a petri plate with bacteria, we can instead throw them onto a plate with a cell culture designed to simulate, say, the production of the amyloid associated with Alzheimer's. It's not a great leap forward, but it's better than what we had before.

A fanatic is a person who can't change his mind and won't change the subject. - Winston Churchill

Working...