Forgot your password?
typodupeerror
Science

Celera Maps Entire Fruit Fly Genome 123

cjoh345 wrote: "Celera Genomics has just sequenced all the genes in the fruit fly. Apparently the scientists involved are amazed at the genes that we share with this dorm-room annoyance. This discovery also validates Celera's "shotgun approach" to mapping out this stuff. And yes, the genome is available free of charge via Genbank. Good form, Celera!" What would Mendel have thought of this? How about Watson and Crick? This makes me want to break out my copy of The Double Helix .
This discussion has been archived. No new comments can be posted.

Celera Maps Entire Fruit Fly Genome

Comments Filter:
  • by Anonymous Coward
    Actually, the high-throughput analysis of proteins is generally referred to as "proteomics" (referring to the human "proteome" as the complete set of expressed proteins). Several organizations, public and private, are gearing up to do this.
  • by Anonymous Coward
    Stock options ? Shame on you!

    This is just marketing.

    If you read the science paper, it doesn't really explain how the whole genome assembly was done, the source is closed, and there is a patent pending on the assembly algorithm.

    Not really enough info for reproducability of results

    --

  • by Anonymous Coward
    I think what is needed is an 'HGPL' -- a Human General Public License, inspired by the GPL.

    Shudder. No, we DEFINATELY do not want this. If the human genome were GPLed, any package (for example a human) which includes the GPLed material (the human genome) would have to be publicly available for free.
    Produce one human (ie, have kids), and you immediately have people saying "I want my copy!"
  • Celera is already 98% done, fool.
  • I thought that this and E. coli were one of the first genomes to be mapped some years ago. Is this old news?
  • If there's that much in common, it's going to be hard to patent it.

    And how is Microsoft going to get a monopoly if they re-use the same tired old techonology? After all, if Unix/Linux at 30 years is too old and must bow down before the young upstart W2K nee NT, surely the new M$ genome will supplant the old human stuff?

    No, surely the future lies with proprietary genomes. This will automatically enforce species separation as a much harder line than currently. This closed source genome will be much more secure against viruses and DoS attacks than the current genomes, which are constantly under attack from both DoS and DDos crackers.

    Follow the proprietary genome into the future! Leave your tired old baggage behind you!

    --
  • ``This sequence may be the Rosetta Stone for deciphering the human genome,'' Thomas Kornberg of the University of California San Francisco and Mark Krasnow of Stanford University wrote, referring to a slab of stone, inscribed with the same story in three different languages, which allowed archeologists to finally decipher Egyptian hieroglyphics.

    I work at another biotech company, Rosetta Inpharmatics [rii.com], which doesn't do exactly what Celera does, but also involves genes (Gene Expression analysis and storage, etc). But it is nice of them to advertise for us!

    But i don't think that the fruit fly is going to be the Rosetta Stone anyway, because from what i've heard, there are no wild type fruit flies left anymore. They've been used so much in genetics research that you couldnt find a natural fruit fly if you looked!

    But just because i'm a programmer in the Computational Biology group doesn't mean that i actually know anything about biology! (i dont!)
  • A couple of questions spring to mind :

    • What's the expected error rate? 1 in 1000 is barely adequate, anything better than 1 in 100,000 and I'll be impressed.
    • How many separate sections (contigs) is it in, and what's their average length? Ideally this would be quite high - megabases or better.
    • Can we see the trace data too? How about quality info per-base?
  • That means the Celera shotgun pieces
    have been ordered, except for 1200 pieces
    that haven't been worked out yet.
  • According to NYTimes article
  • Most of the announced genomes have been single
    cell, except for a simple worm. I guess this
    is largest so far. Two mammals- the lab rat and
    human are near completion.

  • Some of the press reports today say as many 90%
    of fly genes are in humans. That is not too
    surprising, considering we diverged about 600-800
    million years ago, thus have a 80+% shared
    evolutionary history.

    I'd write more, but have to fly off to suck some
    fruit now!
  • There are several gigabytes of human and non-human
    CTAG sequences freely available on the Web.
    Most of it hasn't been interpreted yet.
    They can find where protein coding start/end
    and give similarity measures to know proteins,
    but most is unknown.

  • They've been working on it for years, but completed it now.
    They've been working a human for a decade,
    but will complete it in a few months.
  • ``This sequence may be the Rosetta Stone for deciphering the human genome,'' Thomas Kornberg of the University of California San Francisco and Mark Krasnow of Stanford University wrote, referring to a slab of stone, inscribed with the same story in three different languages, which allowed archeologists to finally decipher Egyptian hieroglyphics.

    I think it's sad when the news media has to explain what the Rosetta Stone is.

    (Presumably the dumbass cub reporter sent to cover this one didn't know what it was, either.)

    I'm really starting to agree with E.D. Hirsch [appstate.edu] as I slowly get older. And to think I wrote an opposing critique of him my freshman year.

    It's bad enough intro-to-computers classes have to teach people how to use a mouse. They shouldn't have to have the most fundamental topics of human history explained to them on top of it.

  • Yahoo's running a bit behind on that story! In my biology class over 20 days ago the professor made reference to the full genome of the fruit fly being sequenced. I presume it was completed quite a bit before then. Visit: The online course notes [umass.edu]

    And click on "Timeline of some Relevant Biological Discoveries"
  • Naw, but I should have phrased it differently, you're right. :)

    It's just that research in the genome has advaned so far from their apprehension of its form I bet they're downright stupefied ...

    The homepages you helpfully point to are interesting, not least for their modesty. Pretty low-key, considering hteir most famous achievement.

    timothy
  • <i>This is a wonderful accomplishment - now we can get started on the main problem.</i>

    The main problem, ie figuring out what the genes actually <i>do</i> in a living organism, has for the most part already been solved. <i>Drosophila melanogaster</i> is probably the most studied eukaryote (non-bacteria) organism, being used in high-school biology classes and graduate research programs. It's easy to take care of, has a short generation time, and many mutations are easily determined by their physical or biochemical effects on the organism as a whole. Most if not all of the genes, as well as their relative locations on the chromosome have already been determined empirically. That is, they knew where the gene lived and what it did, but not what its exact makeup was. With the actual sequencing complete, we can begin to alter the genome intentionally and specifically, instead of just breeding for different mutations.

  • Re: "What would Mendel have thought of this? How about Watson and Crick?"

    I know that at least one of the Watson and Crick duo was alive and doing reseach into cog-sci as of last year. . . and signing books at my university. =) I have a friend that got his high school bio book signed by him. =)

  • The post says what would Crick have thought of this. As far as I know, he is still alive. FYI.
  • "And to the few posts I have read which think that this is some sort of private enterprise success story versus a slow blundering government, it isn't. It is a classic example of business going after the highly profitable bits and leaving the taxpayer to fund the basic research. The same basic research which incidentally made it all possible in the first place."

    Business people can tend to be unwise by waving a technological wand before completely realizing the consequences. I doubt, though, that government-controlled science is any wiser since this tendency is present in most people anyway, be they in business or not. The reason that the highly profitable bits are profitable is because they are useful. People don't pay for things that aren't useful in their eyes. The market forces people to work efficiently and go for the most useful aspects of science, which, in the short run are the actual benefits to humanity, and, in the long run are the underlying theoretical structures. A company that invests time in advancing the theoretical will profit later on when its deeper knowledge allows it to outperform all the rest in practicalities that have the potential to help the "here and now" which is the only life we actually live, by definition.

    In order to provide an incentive to company research, a company should not be forced to give away its trade secrets away for at least a few years. When other companies see how much the wise business (and its customers!) are profitting, they will scramble to bring their theoretical structure up to date. If other companies haven't come up to date in a few years, the original company will be forced to share its secrets, making a serious checkmate impossible.

    Perhaps many people don't like this scenario because they are prejudiced against businesses that have served customers well enough to have been able to grow in capacity to serve -- i.e. "big business." It amazes me that the selfsame people are so much in favor of government which is both bigger and wields actual violent power.

    I see the free market approach to science as an efficient way to harness human nature to acheive practical and theoretical progress. For those who feel that business-sponsored science would be a shoddy rush-job, I point out that it will certainly be faster, as shown by the speed of the government-sponsored genome mapping vs that of the free market. Will it be shoddy? It's not in a business's long term interest to do a crappy job. As a closing note I'd like to point out VA and its SourceForge as an example of a company that really knows what's good for it.

    Perhaps I'm full of crap, but I bet that what I said has a grain of truth. Please respond and we can talk about it.

    --
    Peace, education, prosperity, and a clean environment:
    find out how the free market does it right.

  • heh a beowulf of Celera... actually that sounds like the plural of Celeron...

    --
    linuxisgood:~$ man woman
  • Plus, Celera is using our (PE Biosystems) 3700 DNA Analyzer (fully automated, unattended operation 24 hours per day), whereas the Human Genome Project mostly use our older 377 DNA Sequencer, which requires manual reloading of samples after each run (every 2-3 hours).

    I work at one of the US HGP centers. Our 377s are long gone. Detection is a room full of >100 ABI 3700s....

    As for your 3-month lag period, we aim for a 24-hour lag period. :-)

  • I think that they should make a distributed program for cracking the human genome code, i'd drop the mprime [entropia.com] project in a second :)

    -motardo

  • While it's true that there is still a lot to learn with regards to how living organisms function, it isn't as if we didn't know anything before we could sequence. Much of the core functionality common to all living systems had been already elucidated early in the 20th century, even before we knew that nucleic acids were important. Just read a biochemistry textbook to see how far we've gotten without sequences of entire genomes. While there is a lot we can do with sequence info that we couldn't do before, I think most of our basic biological knowledge will still be derived from biochemical and molecular physiological experiments.

    A better analogy for having the sequence info is like if Microsoft decided to release the source to Windows. Sure, we'd find out a lot of things we didn't know before, we'd find out specific implementations of algorithms, but it wouldn't necessarily tell us anything people didn't already know about operating systems in general. Obviously sequencing is not useless--it's definitely been one of the reasons we've been making so much progress lately--but it isn't the most crucial factor in figuring out how living systems work.

  • Celera's just giving this info away to appease everybody else and take attention away from them competing with the Human Genome Project which they will complete 4 to 5 years before. Do you think their going to give that kind of info away ? Bullshit.
  • Now Ill be surrounded by super-fit, healthy fruit-flies while I continue to suffer Crohn's disease.

    Life could not possibly be crueler.

  • you really are a fucking moron.
  • Does anybody know what assembly software they're using, and on what platform? I'm going to assume they're not using Sequencher (not good for big sequesces).

    Since they are PE affiliated, are they using PE's unix-based system (or did that never hit the market)??
  • I think (though I'm not completely sure) that they're both still alive. If not, one of them must have died fairly recently and I hope I'd have heard about that.
  • Try posting on the Borland message board [cprogramming.com] at cprogramming.com [cprogramming.com].
  • Watson and Crick should be correctly remembered for deducing the bond angles between the ribose sugars that hang the nucleaic acids, and that though crystalline xray images. Do they care that all the codons for Drosophilla have been enumerated? I doubt it.
  • Maybe they store all their data on an EMC Celerra
  • And why should they give any of it away anyway? They're certainly paying millions and millions of dollars for it. The fact that they're giving away the fruit fly genome is a respectable offer to the scientific community.
  • Thank you, brother! As far as I'm concerned, a genome has not been completely sequenced until I, and all the other bioinfo hackers out there, can get a list of reliably predicted and translated ORFs to work with. Just like a protein structure is not useful until it's in the PDB, genomes aren't "complete" until the average biomed lab can use the data to design/interpret experiments, etc. -Stefan
  • FWIW - Celera had annouced that they finished the fruitfly genome over a year ago... But they didn't actually have the sequence to back up the claim until last month.

    As far as validating the shotgun approach, they still have horrendous problems anchoring their sequence. They've pretty much proven that they can get much of the way shotgunning, but that they can't handle repeats very well. They've pretty much proven that you can't finish a genome using pure shotgunning, but most everyone felt that way to begin with.

    That humans and fruit-flies share considerable sequence homology is also not very surprising.

    As far as releasing the sequence to the public... There really isn't much reason not to. Not so many are interested in Drosophila except as a model organism, and the public sequencing effort has made tremendous headway. Celera itself is suffering pretty poor press and their stock has been pummeled lately (worse, they have a high employee turnover and suffering a sort of "brain drain"). I think releasing their Drosophila sequence and annotation was most valuable to them as a public relations gesture.

  • "Gerald M. Rubin, head of the Berkeley Drosophila Genome Project [celera.com] and lead author of one of the Science papers, says, "about 60 percent or more genes are conserved between fly and human." In other words, nature practices the addage against reinventing the wheel. If you've got a core set of genes that work, why not use them over and over again in just subtly different ways."

    So not only is there a law of conservation of matter and energy, there is also a law of conservation of genetic material. Now what were the drawbacks to Open Source?

  • Yes. We have entered the age of the BioHacker. If you think DOS attacks scare people, wait until the find out about guys like me who moved South America to start a lab and begin hacking life. If you're interested biohacking ground zero is at: BioHacking [onelist.com]
  • Genetics was one of the few things I enjoyed in biology class... I've always wondered about the possibility of actually programming viruses from scratch to do stuff. (Shake hands with me, join my organic Beowulf cluster!)

    Coincidentally, I just cleaned up and reposted the source to The Punnetizer [cjb.net], a program I hacked up to generate a giant Punnet square for a biology assignment. That was fun.

  • Business people can tend to be unwise by waving a technological wand before completely realizing the consequences. I doubt, though, that government-controlled science is any wiser since this tendency is present in most people anyway, be they in business or not. The reason that the highly profitable bits are profitable is because they are useful. People don't pay for things that aren't useful in their eyes.

    I think your statement about waving the technological wand is accurate, but I think your last two statements are not true. Something that is profitable is not necessarily useful. For instance Monsanto developed the sterile Terminator seed which is not at all useful to small farmers who save seeds for use as next year's crop. It is useful to the *owners* of Monsanto because it forces the customers to come back next year to buy another batch of seeds. The addition of DVD region codes is another situation in which a technology (I use the term loosely) to prevent people playing DVD's outside their region isn't wanted by customers. It's there to give control and increased profits to owners, not to satisfy customers. This are many more examples where the interests of owners and customers are not the same, and whenever they clash the owners always win. They are after all decides what's for sale, and we can take it or leave it.

    You are right though in thinking that customers do force business to conform in certain ways to their expectations. For instance a car which blows up all the time isn't going to be purchased by many people, but scrimping on other safety equipment will occur. We all remember how long it took for car manufacturers to put in seat belts, then air bags... Will these car companies go out of business? They haven't yet. For a business to survive it must satisfy both its customers and its owners, otherwise it will lose market share and new investment respectively. Both are essential to corporate survival, and there is a constant tension between the two. And it will be there as long as a market economy exists.

    The market forces people to work efficiently and go for the most useful aspects of science, which, in the short run are the actual benefits to humanity, and, in the long run are the underlying theoretical structures. A company that invests time in advancing the theoretical will profit later on when its deeper knowledge allows it to outperform all the rest in practicalities that have the potential to help the "here and now" which is the only life we actually live, by definition.

    Replace useful with profitable in your first sentence and I'm happy. Nobody goes into business to be useful as far as I know, most people look for stocks with growth potential and good return on investment, not usefulness. As far as companies investing in long term research and development, it generally doesn't happen on a large scale by business alone. Usually government does it, often in conjunction with business. That's really what the HGP is all about, and research grants in general. Once a technology has matured enough, it is handed over to the private sector, sometimes for free. Computers, aircraft, the internet, these were all carefully helped along by government until they were big enough to survive in the private sector.

    date in a few years, the original company will be forced to share its secrets, making a serious checkmate impossible. Perhaps many people don't like this scenario because they are prejudiced against businesses that have served customers well enough to have been able to grow in capacity to serve -- i.e. "big business."

    You mean like Microsoft? J

    It amazes me that the selfsame people are so much in favor of government which is both bigger and wields actual violent power.

    Government and business aren't the enemies you make them out to be, they are actually close friends who work together. In fact the violence that government wields is generally used FOR business, almost never against it. Whether it is Britain using its gunboats to open up China for opium trading, Desert Storm, or just cops breaking up a picket line it is doing it for business. Yeah, government goes after some businesses for pollution and whatnot, but by and large they work together as a team. I don't like either of them.

  • I wanna hack my DNA.
  • Hmmmmmmm, I always knew that most people shared the genes of the fly :)
  • The fruit flies that I know seem to be missing their GPL, but we'll let them off I guess. Besides, they don't seem to have any money so there's no point in suing.

    Maybe that's in the next release or something?

  • Yeah, and we share about 60% of the same genes as a banana ;-)
  • Hold it. My tomatos don't cross-breed with weeds, as far as I know. I don't think yours do, either. Same for those pesticide-ready corn plants. Now, there IS a way for the gene to make the species-to-species hop, but it requires a microorganism that has the right transposing equipment. The gene must be picked up in its entirety, with the right regulatory sequences, and placed in the weed genome where it will not kill an essential gene. Imagine the likelihood of that happening naturally. Why do you think it took so much work to put the foreign gene in the plant in the first place? Harmful organisms are created from freak transposition events sometimes, and there are worse toxins in your local flora and fauna than a whale gene which is probably only making your tomatos as frost-resistant as the weeds already are. There are some very compelling arguments for gene manipulation to improve crop hardiness and yields. I am told this is a conservative viewpoint on the matter, but you may be interested in: "Saving the planet with pesticides and plastic: the environmental triumph of high-yield farming" by Dennis T. Avery.
  • . Actually, this came up in an earlier /. discussion where it was claimed that the HGP uses a single individual as well.

    the HGP uses 4 BAC libraries with some P1s and pacs thrown in, for a total of 6
    caltech libraries [caltech.edu] b,c and d
    pieter DeJongs libraries [buffalo.edu] RPCI-11 and RPCI-1
    and the dupont p1 library(I forget the link, it's handled by a private company now)

    Each library was constructed from a different persons tissue

    jor-el

  • I wonder if Celera voluntarily chose to release this information about the genes of flies, or is doing so only to comply with president Clinton's recent call for open-source genes [cnn.com] LOL.
    ---------------
  • Don't lose hope brutha. You'll get to do it all over again when you are reincarnated. Maybe you'll become one of those damn-fit fruit flies and you can eat all the damn fruit your, thousand or so, eyes can feast upon! At least you'll not be interested in my Hot, Juicy, slab of beef. You can always find refuge in my aquarium. I'll fix you a nice, rusted salad. Don't you understand what is happening?!?! Fruitflies! Fruitflies are happening! So many fruitflies and so little time. I bet there is a hundred thousand uses for mapping the fruitfly's genes. Ah shit! I can't even think of one at this minute. Don't people in india eat maggots'n'stuff? Let's put our heads together and think of something we can do with fruitfly genes...nothing at all! Out of all the public service I have seen...fruitflies! Egad! The excitement in mapping fruitfly genes! We need a mascot. Hurry! Someone be our mascot and make a damn song on fruitfly genes. We can be famous for it! whoopeeedoooo! Were on our way! Lets post our success in mapping fruitfly genes at slashdot's website! They're surely gunna give us money now!

  • If you put your face up to the screen, blur your vision, and slowly bring your face away from the screen, you will see some of Bill Clinton's genes in that sample. 'nuff said; i'm already getting sick in the stomach.

  • There are about 15 different fruit flies in my area. Oriental, dogshit, saskatchewan, dew(melon), chernobyll, and the list goes on. When are they going to resume releasing sterile fruit flies and just keep reducing their numbers? Big stinkin' deal. They probabley fit it onto a legal-size paper. I didn't notice which species they were showing and I want to know when they are going to map the genes of say, the frozen and fresh, wooly mammoth that they want to reserect so badly. Are they planning to map anything else or are they going to experiment with the fruit fly for another week until it expires again? I'm a donater. If they need my genes, by all means, send a cup and rid my future chirdlen of mental illness.
  • lol. I am not a moron. I actually think that it is great that they have mapped the fruitfly's genes. They can use all the help and pr that they can get! When they can accurately interpret their information, then they can practice on more complex organisms. Soon we will be able to help the disappointed boy with Chron's disease. However, we are still on the Fruitfly. The fruitfly is a multicellular animal and they don't know entirely how to understand it yet. Do we realy want them to better understand fruitflies? They are insects and we are mammals. Entomology does not mean "Bug Doctor". It means the study of insects. It will take a lot of genetic research to fully understand the human's genes and with our short lifespan, can't we focus more on us, so we can extend our lifespan and not have to retrain people to study after the ol' professor kicks in? As to what they say, we currently have a limit of 5% on our brain. Lets unleash that with our study on humans. Then we can help other less fortunate animals.

  • Soon, there will be gene theft, genetic sabotage, and more problems, if they document everything and is aloud into the wrong hands. Someone might modify marijuana to produce millions of seeds and release them into the wind every month. This new strain of plant will spread all over the country and will be harder to get rid of. I don't hate marijuana and I don't care about it. That is just an example. Genetic terrorism. lol. Venus flytraps that walk(higher metabolism) and poisonous red roses that will consume other plants and are resistant to agent orange... In other words, there are negative possibilites about publishing the findings of genetic research. It is just another study that we can take part in.

  • i wonder if fruit flies are attracted to the sweet sweet sensation of a bowl of hot grits poured down the pants? thank you.
  • by Anonymous Coward
    Hey, that looks like Jon Katz.
  • Somebody said that if you compare the Genomic mining with the goldrush from the 1850s, Celera is the company selling the maps. Their sister/mother company, PE Biosystems (where I work) is selling the picks and shovels (the sequencers, PCR tools, chemcials & consumables, etc).

    Having mapped the Human Genome will be the platform for about 100 years worth of research, even taken into account the accellerating pace of such research based on technological advances.

    During this time, more and more products will come to market, some of which are human drugs, some of which are tailored treatments (e.g. body tissue), some of which are more informational in nature. For this reason, it is very important that politicians such as Clinton and Blair concentrate on these bigger issues at stake - get debates started on what the boundraries are and what we want to do with this information - rather than trying to score populist points by portraying incorrect/ignorant viewpoints about the private sector's intentions in this race. (I guess, they can't make themselves saviors without enemies, but still...)

    Anyway - glad the bottle is out of the genie. :-)

  • But i don't think that the fruit fly is going to be the Rosetta Stone anyway, because from what i've heard, there are no wild type fruit flies left anymore. They've been used so much in genetics research that you couldnt find a natural fruit fly if you looked!
    Of course there are natural fruit flies out there. They may not be used for research (I have no idea), but a genetically new fruit fly is interesting to the researchers anyway.

    For example, this weeks issue of Nature [nature.com] has an article about constructing a model of Parkinsons disease in the fruitfly. This is probably a great tool to test drug candidates on. Fruitflies are somewhat cheaper and more convenient to experiment on than human beings. ;-)


    Lars
    __

  • I hereby declare my genetic resources to be open source, and will cheerfully assist any human female that wishes to make use of them.

    Oh... sorry, dear, I didn't know you were reading over my shoulder.

    I hereby rescind my previous decision re: my genetic resources...

    --
  • I noticed something a little odd in the timothy's post - he says

    What would Mendel have thought of
    this? How about Watson and Crick?


    This seems to imply that Watson and Crick are as dead as Mendel, which is just not true. Watson is the president of Cold Spring Harbor research institute. His homepage is here [cshl.org]. Crick is also alive and doing some rather interesting research in the neurology of consciousness at the Salk Institute. his homepage is here [salk.edu]. I met Dr. Crick while working at the Salk, and he's a really nice guy. I've met a number of famous people in my time, but he really awed me. Its hard to talk to him without thinking about the massive influence he has had on modern biology.

    If I had to guess, I'd say that they are both as amazed by modern biology as the rest of us. Who could have guessed we'd be this far so soon? Biology is amazing. Computers are amazing. That's why I do both.

    ted
  • I guess the next logical step would be to mass produce giant mutant fruit flies the size of cows and then harvest them for food?

    Well you know what they say...

    "Five a day for better health"

  • I've got nits to pick with the rest of what you said, but I'd like to focus on your last remark:

    Now what were the drawbacks to Open Source?

    By this, I'm assuming that you're putting the human genetic condition up on a pedestal. Are you really all that confident that things have developed in the best way possible?

    Forget chromosomal, mitochondrial, or multifactorial genetic disorders -- serious single-gene disorders alone are estimated to have an incidence of about 1 in every 300 births. Not exactly something to write home about, there.

    Cheers,
    ZicoKnows@hotmail.com

  • Correct in some parts. However, what most people don't seem to look at is that organisms are not static. You don't derive the output of a protein solely from the perceived input of a gene sequence. There are other considerations.

    I think you hit the nail on the head with this post. I actually thought that the original poster's analogy while true in some senses was slightly confusing. By talking about the genome as being like a physical object solely it ignores the fact that it is, as your post brings out, like a program that has physical parts. This way of talking about it:

    • manages to obscure the recipe or instructions dichotomy.
    • epistatic interaction
    • the stochastic nature of some of the "program"
    • the role of local molecular differences in the starting state of the "program"

    It might be clearer to use the analogy of two groups of Victorians being presented with a wonderful little nanobot composed of intricate parts beyond our wildest dreams. The nanobot has been produced by several aeons of amateurish Basic programmers and kindergarten Lego-engineers who have piled fudge upon fudge to improve the thing in response to changing design specs from their PHBs. It is written in a proprietary binary-block format.

    One group of scientists decides to study the program that each part of the nanobot carries around, the other group decides to study how the parts fit together and what happens when you take parts out and put them in. Now, the proprietary file format has been decoded and we can look at it as ASCII text. Yee-haww! Oh wait! this is terrible code: goto's , overloaded operators (not that that's always bad, I just hate it personally), no or little documentation. We're going to be a long time figuring out this program.

    Calling it the "rosetta stone" similarly is a confusing way of putting it - the rosetta stone had the same text in different languages. This is different texts in the same language. The "words" may be the same in the different "essays", may even have similar patterns of usage in "sentences", but the meaning is damn different of each essay.

    Don't get me wrong, I think this is an essential first step (as long as they finish the hard bits...90% only?) but there's a lot of work yet. I'd also like to draw people's attention to the skepticism of some scientists about the assumptions of determinism that are built into this work - you bring this out very nicely in your discussion of the 3D string folding problem of synthesized peptides.[ References:

    Not in Our Genes:Steven Rose and Leon Kamin Biology as Ideology:The Doctrine of DNA Richard Lewontin]

  • If this is the same company that I'm thinking of from a couple years back, they developed this shotgun approach, and were going to finish the fruit fly genome as a test run (it was supposed to be finished by 2000). If they are still following their initial plan, they will now start up on the human genome. They had originally said that after they finished the fruit fly, they'd start the human genome from scratch and still finish it before everyone else. I think they said they'd have it done by 2003. But this is what they were saying probably 2 years ago, so they may have changed everything by now.

    Mike
  • If you create a human, you don't have to make
    the source public, unless you DISTRIBUTE it.
    Either selling it, renting it, or giving it away.
    This probably means we need the source for
    hookers, slaves, or married couples.
    Perhaps also media-prostitutes, consultants,
    and adopted children.
    But you don't have to give away YOUR copy, just
    let other people clone you.

    I can hear all the "anonymous cowards" screaming:
    "I want my copy of Natalie Portman, and hot grits down my pants".
  • Celera is doing a 4x oversampling on the human genome, unlike the HGP, which does 10x oversampling. This is possible because Celera is sequencing DNA from one single individual (most likely Craig Venter?), thus avoiding the uncertainty of wheter differences are due to sequencing artifacts or personal variations.

    Doesn't this reduce the value? I would have thought that the most useful use of a gene map would be to be able to tell which parts of an individual vary, and cause us to be different, which parts are always constant, and those parts which vary only in those who are carriers for gene defects.

    If you only map one individual, and that individual has the gene which causes blue eyes, or sickle cell anemia or breast cancer, then that is going to be considered 'normal'. If you map 10 invididuals, and find that 9 of them have the same code and 1 varies, then the one which is found in the majority will be considered 'normal'.

  • I'm all for mapping the genome, but there are things you have to remeber when you start "tinkering" with it.

    For example, did you know there's a whale gene in your tomato? There is, and the reason's it's there is to prevent it from freezing (or at least making it harder to freeze).

    Good things: production goes up, losses go down. Bad things: weeds that don't freeze and die in the winter.

    This is just a simple example, but some of our crops are genetically enhanced for pesticides. Now what happens when our crops undergo natural pollination and cross breed with weeds?

    I read an article about this a few months ago, and I wish I could point out the exact name, or give some links on topics like this, but it was a gardening magazine, and has since disappeared.

    This is the reason why Europe boycotts some of our crops.

    And for those that are didn't know, they use modified viruses to implement the genes :) Excuse me, I have to run off to class now.
  • I looked through the genome database here [nih.gov], and only found sequences from last August for Drosophila.

    Someone else mentioned that there was a 3 month waiting period by the company before release.

    Does anyone know if the actual genome is publicly available somewhere? I was thinking of republishing it via Project Gutenberg [promo.net] (we've done the draft human genomes that have been released already).

    • Greg
  • Check out the Berkeley Drosophila Genome Project, which also contributed to the sequence at http://www.fruitfly.org [fruitfly.org] It's not just a private business venture.

    It also needs more work--it's not exactly the entire genome yet.

    At this time, ~92% of the genome is in contigs larger than 30kb, and ~78% in contigs greater than 100kb; most gaps are small (3kb or less) and due to genomic repeats, such as transposons.

    If the entire sequence is 120Mb, that's a whole lot of pieces they still have to put together. Right now it's already probably good enough to do analysis of protein structure and a lot of the aspects of gene regulation, since they've gotten all the euchromatin, although we already know most of this stuff from the work of developmental biologists.

    While the genes they found are interesting and it's great that they actually have sequence confirmation on them, we've probably suspected they were there for years now. Among the more interesting finds was the p53 analog, which controls apoptosis. and whose loss of function in humans is implicated in cancer. But this type of gene is expected to be found in all species that undergo regulative development. The SOD1 analog discovery was also interesting--in humans, this is one of the suspects for the cause of ALS. Its function is to clean up superoxides (perhaps lending credence to the theory that anti-oxidants will let you live longer), and so it wouldn't be that surprising to find something like it in all organisms that do aerobic respiration.

    On another note, the progress with sequencing the Drosophila genome may not translate over to the human genome project, because working with Drosophila DNA has a huge advantage: genes are often present in multiple copies within a cell, due to polytene chromosomes. Instead of just having 1 set of double helices per chromosome, you could have 1024 sets or more.

    Finally, I just wanted to quibble over the usage of the terms "map" and "sequence." Though they are similar, they are definitely not the same thing. The Drosophila genome could be said to have been mapped thirty or forty years ago, when Morgan did his work. (The units used to describe map distances are named after him) Mapping is the ordering of the genes--determining what chromosomes they're on and how far apart they are from one another. This is often sufficient to determine a lot of things, like inheritance patterns and rates of mutations. Sequencing is just getting the base pairs. A lot of the work will be to get the map and the eequence to match.

  • Top Twelve Rejected Slogans at Celera:

    12. Maximizing current shareholder value for the good of humanity.

    11. Have you seen our famous "Geewhiznomics!" roadshow? It's Not Real Science, but an Incredible Simulation.

    10. Proving Adam Smith right, one basepair at a time.

    9. Now available for licensing: Professionally packaged, Fully Annotated Roman Alphabet Plus(TM).

    8. No, Uma Thurman and Ethan Hawke don't actually work here.

    7. Celera. Not At All Like Microsoft.

    6. "We will bury you, decadent academicians."

    5. Just your friendly neighborhood giant corporation profiting from publicly funded reasearch.

    4. Have you seen our new island fortress?

    3. Proud underwriters of the Aldous Huxley Chair of Biology.

    2. Celera. Not At All Like Microsoft.

    And the top rejected slogan for Celera....

    1. Annotators wanted starting $5.50/hr (nights).

  • Apparently the scientists involved are amazed at the genes that we share with this dorm-room annoyance.

    Never throw away good code that works!

  • "Analysis of the Drosophila genome revealed 90 previously unknown P450 genes, including those that affect the metabolism of drugs such as beta blockers for heart disease, antidepressants, antipsychotics, and codeine-a pain killer and cough suppressant. (No one knows whether a fruit fly can get a cough.)

    Patient to Doctor:"Doc that gene treatment you gave me for my depression really worked well. But you know ever since I've had this strange urge to walk through s#@t."

  • Kudos to Celera for releasing the fruit fly genome to the public.

    But this brings to the public eye yet again the concept of patenting gene sequences. Yeah, software patents are a concern to me, but patenting the code that makes me what I am really scares me.

    I think what is needed is an 'HGPL' -- a Human General Public License, inspired by the GPL.
  • "Having a complete map of a creature's DNA tells us, in principle, all of the proteins that it can synthesize throughout its lifetime. This gives us the building blocks that the creature uses to build things, and the chemical signals that it uses to direct internal operations.

    This is wonderful, and essential. To use an analogy, this is like a Victorian scientist, after years of studying a 1999 notebook computer, managing to deduce how transistors and the wires that connect them work. "

    Correct in some parts. However, what most people don't seem to look at is that organisms are not static. You don't derive the output of a protein solely from the perceived input of a gene sequence. There are other considerations.

    Even assuming a wonderfully simplistic gene (no introns, single well-defined promoter sequence, well-defined "end" sequence) - all you receive from this is (essentially) a one-dimensional string of peptides. The problem is that the string doesn't stay "one-dimensional" for long. As sections of the string exit from the ribosome, they begin folding into two- and three-dimensional structures, due to environmental factors (an example being how pH affects binding affinity between protein domains). While protein modelling has advanced enormously, it is still wildly insufficient to accurately predict the outcome of domain/finger interaction necessary to generate any but the most simplistic protein structures.

    In a nutshell, seeing the peptide sequence for a gene gives you about as good of an idea what the final protein will look like as seeing one bit-representation memory map of a self-modifying program will allow you to determine what the final outcome of the program will be (not to mention not knowing which *parts* of the memory map are actually part of the program and which are parts of the environment ... )

    So, yes, there's still *tons* of stuff left to do. But the Victorians will fully understand their computer a heck of a lot sooner than we will fully understand our genome and how such a self-repairing, self-modifying system interacts with a wildly dynamic environment like a cell under stress. :-)

    TTYL,

    Scott Ferguson

  • by Anonymous Coward on Thursday March 23, 2000 @10:53PM (#1177758)

    Yeah, so they released the Fruitfly source code. Just what we need--soon the OSS community will stomp all the remaining bugs in the bug, and we'll have a stable, reliable, and high performance pest.

    On the other hand, I'll bet you a thousand dollars that they never release the source to a really valuable product, like Christy Turlington. Greedy corporate bastards.

  • by Lars Arvestad ( 5049 ) on Thursday March 23, 2000 @10:44PM (#1177759) Homepage Journal
    For a more informative source, check todays issue of Science [sciencemag.org], which includes a special about the feat. If you register, you get to read abstracts of the articles. This alone is quite informative.


    Lars
    __

  • by irongull ( 9022 ) on Thursday March 23, 2000 @10:58PM (#1177760)
    I've spent the better part of the last year massaging the drosophila genome with perl scripts. I am intimately familiar with it, and I can tell you that it is NOT complete. While it is 90% sequenced, it is still in a bazillion tiny pieces. This makes it difficult to get complete sequence for many genes, as they may start in one contiguous piece and end in another. From personal experience, I would guess that about 15% of the genes are split like this.

    And even if it were complete, this still wouldn't tell us where all the genes are. Its very difficult to string coding regions together into a complete gene, when there may be large introns that confuse the matter. The state of the art still only identifies about 70% of genes correctly, even given complete sequence.

    And even if we did know all the genes, we still wouldn't know how they interact. We can make guesses based on previous experimets, but the majority of the genes in a given genome are experimentally uncharacterized. Current attempts at molecular simulations can't even predict how these proteins will fold, let alone with what other proteins they interact, or what they do.

    There is still a lot of work to be done - getting the genomic sequence is only the beginning. A significant start, but only the first step. Could you reverse engineer the entire linux kernel if you were only given the binary? Probably not. I assure you that deducing the operation of an organsim given the raw DNA code is much more difficult. The complete sequence of the E.coli (an intestinal bacteria) has been available for a couple of years, and we haven't even begun to understand it. E.coli is single celled, and the genome is only 4.5Mb (thats megabases). Drosophila is very complicated, and the genome is about 120Mb. Don't look for anyone to 'solve the fly' any time soon.

    Its a great time to be in bioinformatics - tons and tons of data that noone understands. If we did understand it all, I'd be out of a job. I'm not worried.

    ted
  • by Graham Clark ( 11925 ) on Friday March 24, 2000 @12:33AM (#1177761)

    human genome (more than 200trillion base pairs)

    A bit over 3,000 million, actually.

    To compare, the government-funded Human Genome Project has so far spent over 10 years on the same job.

    There's been a lot of mapping done, that Celera is actually using at one remove, because they're picking up our data for their assembly. Celera's job would have been a lot harder if our work hadn't been available to them.

    Celera is doing a 4x oversampling on the human genome, unlike the HGP, which does 10x oversampling. This is possible because Celera is sequencing DNA from one single individual (most likely Craig Venter?), thus avoiding the uncertainty of wheter differences are due to sequencing artifacts or personal variations.

    The extra depth is more to do with accuracy. Incidentally, does anyone know when Celera ditched their aim to collect lots of variation data? That was going to be their great contribution to human knowledge, and their main selling point. When did they change their minds?

    Plus, Celera is using our (PE Biosystems) 3700 DNA Analyzer (fully automated, unattended operation 24 hours per day), whereas the Human Genome Project mostly use our older 377 DNA Sequencer, which requires manual reloading of samples after each run (every 2-3 hours).

    As I've pointed out, here at the Sanger we've got more than 100 3700s : other institutions have gone for MegaBace machines instead.

  • by RJ11 ( 17321 ) <serge@guanotronic.com> on Thursday March 23, 2000 @10:14PM (#1177762) Homepage
    I guess the next logical step would be to mass produce giant mutant fruit flies the size of cows and then harvest them for food?
  • by yuriwho ( 103805 ) on Thursday March 23, 2000 @10:42PM (#1177763)
    In what they call an ``initial reconstruction,'' the researchers state up front that they must still analyze their map and that their work is far from done.

    From their press release....they have a map, they don't have the sequence yet. A map is a guide with landmarks as to where major chunks of sequence fall within the genome. Celera has pioneered the approach of shotgun cloning. They randomly capture chunks of the genome and sequence them. If they do this enough times (10-50X genome size) they will ultimately have the entire genome after some sophisticated algorithyms sort the data and place it onto the map. They probably have most of the genome and have a few difficult bits to figure out (some sequences are harder then others to get).

    Some searching reveals the NCBI press release [nih.gov]. Looks like they have most of the sequence together. I'll bet berkeley provided the map which is allowing Celera to put their info together.

    The big question is: Has Celera already filed patents on every ORF it has found; Will the patent office grant the patents; Will Celera get patents on the human homologs of these genes (they have identified most of the homologous sequences from EST's in the human genome project).

    And you thought software patenting was fusked.

  • by yuriwho ( 103805 ) on Thursday March 23, 2000 @11:08PM (#1177764)
    You are absolutely correct! The next misson (after sequencing the genome is to figure out what all of those genes(proteins) are doing. So, onto the human structome project (structures of every protein that has been inferred through sequence) and the functome (functions of all genes that have been inferred from sequece data). I think 50 years is a resonable estimate. Things may accellerate a little once physicists (and coders) get involved and start creating models of signaling networks within cells. Models that predict real cellular responses to the additional expression of genes X & Y will be the one that begin to understand how cells operate.

    Just think how different coding will be 50 years from now.

  • Similarly, we can now move on to the next step in understanding biological creatures - trying to figure out what all of the proteins do, and how the systems built from them operate and interact with other such systems.

    This would not be an easy task under the best of circumstances. It's made worse by the fact that evolution puts little value on modularity - the systems will interact with each other to such a degree that it will be difficult to even define individual systems within the chaos that is an evolved being.

    Fortunately, things aren't quite as bleak as you portray them. Many, many proteins do in fact have a single, clearly defined primary function, either by themselves or as part of a larger complex. Those proteins can have their function inferred either by watching them catalyze reactions, deleting them and seeing how it affects celluar function, or comparing them to similar proteins from the same or other species.

    More promisingly, new techniques of functional genomics and proteomics are being developed to analyze protein function by looking at more subtle factors. To find the function of a protein of unknown function, you can find out what other proteins it interacts with and infer what role it plays. You can also grow cells or organisms under different conditions and look for changes in levels of gene or protein expression to determine what proteins are associated with specific metabolic or other life states. Some very interesting work is also being done by determining the 3D structure of proteins (either by analysis or simulation) and predicting function based on structure.

    The tools for the next big thing are out there. It's just a matter of going through the long grind of applying them. It's going to be a very long road, probably much longer than the process of sequencing the genome, but finding out (to a rough and ready approximation, at least) what every protein does is an accomplishable goal.

  • by Tor ( 2685 ) on Thursday March 23, 2000 @10:06PM (#1177766) Homepage
    Actually the sequencing part was completed earlier this year (giving tremendous subsequent rise to Celera stock). What they now did was the mapping - i.e. piecing the small fragments together.

    Moreover, Celera have also completed more than 90% of the human genome within the last year or so. Once complete, this is an indication that the time before the human genome (more than 200 trillion base pairs) are mapped will be shorter than originally anticipated. To compare, the government-funded Human Genome Project has so far spent over 10 years on the same job.

    Celera is doing a 4x oversampling on the human genome, unlike the HGP, which does 10x oversampling. This is possible because Celera is sequencing DNA from one single individual (most likely Craig Venter?), thus avoiding the uncertainty of wheter differences are due to sequencing artifacts or personal variations.

    Plus, Celera is using our (PE Biosystems) 3700 DNA Analyzer (fully automated, unattended operation 24 hours per day), whereas the Human Genome Project mostly use our older 377 DNA Sequencer, which requires manual reloading of samples after each run (every 2-3 hours).

    As originally stated when Celera was created two years ago, the data is going to be publicly available - a point that has gotten lost among very opinionated but not so informed readers of Slashdot. There will be a 3-month lag period, to ensure accuracy of the data, and to see if there is any information that could be used for patentable drugs & applications.

    (Mostly, Celera's business model is based on providing the tools that will give access to this database).

    And I have stock options! :-)

    -tor

  • by Lars Arvestad ( 5049 ) on Friday March 24, 2000 @12:52AM (#1177767) Homepage Journal
    The comparisons you make are quite unfair. First of all, the Drosophila project was done in cooperation with the US funded Berkeley Drosophila Genome Project [fruitfly.org]. That alone should keep you from barking at the government funded projects.

    Second, the fact that HGP has been going on for 10 years (how long has Celera been going) means nothing when the sequencing capacity seems to double every year. This means that you in one year can recover what has accumulated over several years of work!

    Third, HGP is making their data public within 24 hours. You think Celera doesn't make use of that data?

    I am also uncertain about your oversampling claims. If Celera is content with 4x and do not use public sequences (which they can't if they are supposed to be ahead), then they will have serious problem of actually connecting the pieces. Granted, you can still go gene-mining and make important discoveries. Also, I think (due to the competition) that the HGP has settled for 5x oversampling to get a rough draft available later this year. Whether there is one or more individuals sampled doesn't really matter. You are fighting statistics which says that you need 10x if you are going to have any hope of connecting the pieces. Notice that they used 14x for Drosophila. Actually, this came up in an earlier /. discussion where it was claimed that the HGP uses a single individual as well.


    Lars
    __

  • by Brento ( 26177 ) <brento AT brentozar DOT com> on Thursday March 23, 2000 @09:23PM (#1177768) Homepage
    Here [celera.com] is a much more detailed link of the story from Celera's site, talking about the similarities between our genes and the fruit fly's. (I've got a dollar that says their computers are all Celerons, ha ha ho ho.)
  • by ozborn ( 161426 ) on Thursday March 23, 2000 @11:36PM (#1177769)

    Celera hasn't even by their own definition sequenced the entire genome of Drosophila. What they have done is sequenced most of, or all of the euchromatic region. The highly repetitive heterochromatic DNA that is clustered around the centromeric regions and makes up an estimated 30% of Drosophila genome is not sequenced. There may even be some B-heterochromatic regions which are also unclonable which is a serious problem in trying to sequence highly repetive DNA. While these regions don't have the glamour of the gene-rich euchromatin (it is often referred to as junk DNA for that reason) they can effect everything from gene expression to chromosome pairing.

    And to the few posts I have read which think that this is some sort of private enterprise success story versus a slow blundering government, it isn't. It is a classic example of business going after the highly profitable bits and leaving the taxpayer to fund the basic research. The same basic research which incidentally made it all possible in the first place.

  • by jor-el ( 164726 ) on Friday March 24, 2000 @12:55AM (#1177770)
    this is misinformation tor,

    1) much like all the comments here your posting neglects to mention berkeleys fruitfly genome sequencing project that did a vast amount of work and without which celeras data wouldn't have been nearly so useful. it certainly wouldn't have made it to finished so quickly without the mapped BACs would it? which leads to point

    2) this crap about celera mapping 90% in one year when the public efforts spent 10 years blah blah blah. This really ticks me off, from the very start the plan with the public effort was to spend the vast majority of time developing the technology and techniques necessary to sequence rapidly and accurately, the accelerated curve has been known for ages and our lab went from sequencing apx 2 mb/year to 20 mb in (I think it was) 98 to over 350 mb now seq stats [doe.gov]
    Considering that massive purchases of 377 sequencers and scientific collaborations by the hgp contributed VASTLY to the development of the 3700 it's rather crass to read the crowing about how celeras kicked ass while the public effort allegedly just sat around twiddling their thumbs. The press releases [pecorporation.com] from the formation of celera at least give credit to the planning of the hgp
    Since the inception of the Human Genome Project (HGP) in 1990, a major shift in technology has been anticipated that would allow the entire sequence to be completed

    3) The HGP is now likely sequencing FASTER than celera, I know the doe has 80 megabases(equivalent to the 3700), sanger has 100 3700s and a ton of 377s, that's only 40% of the genome project and celera has what, 230 3700s? hrmm, rough unsubstantiated calcs would put total human effort near least 450 3700s ... ouch! Plus MIT now has more than any other group I believe, (although they aren't all working on human) and there's the vast capacity at washU.
    while it's true celera has the largest private supercomputer and that will help with assembling, the DOE started the human genome project, is still involved and just happens to have the largest supercomputers period.

    4)where you get the 10x oversampling number I haven't a clue. the goals are laid out here [doe.gov] and additionally a figure of 6x is generally aimed for before trying to finish the clone, finished is still the bahama definition of I believe no more than 1 error per 10k

    yeah, I'll bet you have stock options and I'm sure they don't bias your postings and don't influence your continued use of outdated figures

  • by Christopher Thomas ( 11717 ) on Thursday March 23, 2000 @09:49PM (#1177771)
    This is a wonderful accomplishment - now we can get started on the main problem.

    Having a complete map of a creature's DNA tells us, in principle, all of the proteins that it can synthesize throughout its lifetime. This gives us the building blocks that the creature uses to build things, and the chemical signals that it uses to direct internal operations.

    This is wonderful, and essential. To use an analogy, this is like a Victorian scientist, after years of studying a 1999 notebook computer, managing to deduce how transistors and the wires that connect them work.

    He still needs to deduce a lot about capacitance, resistance, and inductance to tell how signals will propagate and influence each other, and needs to build up from scratch all of the disciplines involved in integrated circuit design before he can understand how it works, but it's a start.

    Similarly, we can now move on to the next step in understanding biological creatures - trying to figure out what all of the proteins do, and how the systems built from them operate and interact with other such systems.

    This would not be an easy task under the best of circumstances. It's made worse by the fact that evolution puts little value on modularity - the systems will interact with each other to such a degree that it will be difficult to even define individual systems within the chaos that is an evolved being.

    I wish them luck. They have opened the door, and made available for study the vast landscape of interacting systems that we'll have to understand to truly understand how living creatures work.
  • by MortimerK ( 22530 ) on Thursday March 23, 2000 @09:27PM (#1177772)
    -----BEGIN FRUITFLY-----
    GATCGATCGATGCTAGCTACGATCTGATCGATCGATCGTAGCTAGCTA
    ATCGTAGCTAGCTGACTATCGTAGCTAGCTAGCGTATCGTAGCGATCG
    GCATCGTAGCTAGCTAGCTACGTAGCTAGCTAGCGATCGTACGATCGA
    CGTAGCATCGTAGCTAGCTACGTACGATCGATCGATCGTAGCTAGCTA
    GACTAGCTAGCTAGCTAGCTAGCTACGTAGCGCGATCGATTCGATCGC
    AGCTTGACTGATCGGATCGTGCTACGGACTGTACGATCGTACGATCGC
    ------END FRUITFLY------

RADIO SHACK LEVEL II BASIC READY >_

Working...