Forgot your password?
typodupeerror
Medicine Science

New Antibody Attacks 99% of HIV Strains (bbc.com) 149

An anonymous reader quotes a report from BBC: Scientists have engineered an antibody that attacks 99% of HIV strains and can prevent infection in primates. It is built to attack three critical parts of the virus -- making it harder for HIV to resist its effects. The work is a collaboration between the US National Institutes of Health and the pharmaceutical company Sanofi. Our bodies struggle to fight HIV because of the virus' incredible ability to mutate and change its appearance. These varieties of HIV -- or strains -- in a single patient are comparable to those of influenza during a worldwide flu season. So the immune system finds itself in a fight against an insurmountable number of strains of HIV. But after years of infection, a small number of patients develop powerful weapons called "broadly neutralizing antibodies" that attack something fundamental to HIV and can kill large swathes of HIV strains. Researchers have been trying to use broadly neutralizing antibodies as a way to treat HIV, or prevent infection in the first place. The study, published in the journal Science, combines three such antibodies into an even more powerful "tri-specific antibody." The experiments conducted on 24 monkeys showed none of those given the tri-specific antibody developed an infection when they were later injected with the virus. "We're getting 99% coverage, and getting coverage at very low concentrations of the antibody," said Dr Gary Nabel, the chief scientific officer at Sanofi and one of the report authors.
This discussion has been archived. No new comments can be posted.

New Antibody Attacks 99% of HIV Strains

Comments Filter:
  • by Anonymous Coward

    Woohoo!

  • Evolution (Score:1, Interesting)

    by Anonymous Coward

    If it doesnâ(TM)t have 100% coverage that means escape mutations are feasible and therefore it will be useless. Basically the antibody needs to be effective against any 6 simultaneous SNPs in the viral genome.

    That means if the initial virus DNA sequence is (for example) tgagcagattcgctggtacgatgacgtactaa
    if the virus can escape with a sequence of
    tgaccagattcgcaggtacgatgacggactaa (five letters have been changed in specific locations). That is no good, because HIV usually has a mutation every few times it c

    • Re:Evolution (Score:5, Insightful)

      by Anonymous Coward on Saturday September 23, 2017 @02:23AM (#55249077)

      If 24/24 of the subjects managed to survive without infection, then it's clearly not useless.

    • Tyrell: The facts of life... to make an alteration in the evolvement of an organic life system is fatal. A coding sequence cannot be revised once it's been established. Batty: Why not? Tyrell: Because by the second day of incubation, any cells that have undergone reversion mutation give rise to revertant colonies, like rats leaving a sinking ship; then the ship... sinks. Batty: What about EMS-3 recombination? Tyrell: We've already tried it - ethyl, methane, sulfinate as an alkylating agent and potent mutage
    • Re:Evolution (Score:4, Interesting)

      by Pseudonym ( 62607 ) on Saturday September 23, 2017 @03:32AM (#55249191)

      99% of strains killed is better than most vaccines. Gardisil is only good for about 70% of HPV strains.

      • That is like comparing buttsex to different quantum mechanics models. They aren't comparable in any reasonable sense, and they do completely different things with different purposes.

      • An antibody is not a vaccine, unless you call a passive vaccination "with antibodies" a vaccine.

        • Oh, absolutely. Just for the record, I was comparing this potential treatment with vaccines because it was the first "percentage of STI strains" figure that came to mind.

      • Regarding HPV: I'm pretty sure Gardisil is still made to only go after the cancer causing viruses. It would explain 70%. Hmm,. looks like they got some new stuff. https://www.cancer.gov/types/c... [cancer.gov]
        • To clarify my original claim, the original Gardisil protected against the strains that cause 70% of cervical cancers.

          And yes, there's a new one.

    • Re:Evolution (Score:4, Informative)

      by TimothyHollins ( 4720957 ) on Saturday September 23, 2017 @08:28AM (#55249757)

      I was about to mod this down, but perhaps explaining all the things that are wrong with this is a better way to go.

      You are correct in that 100% coverage would be needed to kill off the virus. HIV is notorious for repopulating a system if even as much as a single virion is alive. What is completely off is that 6 SNPs would protect against antibody recognition when there are 3 of them, all broadly neutralizing. The antibodies can very well have overlapping epitopes for different patterns resulting in recognition regardless of any variation, as has already been shown to be the case by TFA. Ignoring the entire purpose of the broadly neutralizing antibodies is necessary for your analysis to seem accurate.

      Next, the matters of genomics. If the antibodies recognize any specific phenotype in the viral episome, and that phenotype is conserved, it is quite tricky for the virus to produce an immunity without altering a core protein of itself. Usually, that would not be a problem for a virus such as HIV as there is lots and lots of variation possible within a protein without changing its function, but when dealing with broadly neutralizing antibodies the change must be significant or it will still get caught in a broad recognition. Hence, it is not enough to change a nucleotide or two, that change must result in a significantly different phenotype which means the expressed protein would function differently (or not at all). That is why these antibodies have already been proven to work efficiently.

      In short: no, your interpretation does not represent how it works at all.

    • Idiot very much?

      You are infected by HIV.

      An antibody is "killing" 99% of the virus, and you think: therefore it will be useless, you seem to be a bit retarded.

      every few times it copies itself. Hint:no virus is copying itself.

      Perhaps you want to read the article again to grasp that the antibodies attack "fixed structures" in the virus?

    • by epine ( 68316 )

      If it doesn't have 100% coverage that means escape mutations are feasible and therefore it will be useless. Basically the antibody needs to be effective against any 6 simultaneous SNPs in the viral genome.

      You're advancing a fallacy that all mutations are cost free to the resultant super bug.

      Back in reality, the non-mutated forms where chosen by a selective pressure, and it stands to reason that many of these conveyed a selective advantage (which is sacrificed when a new selection pressure causes it to flip

  • by 93 Escort Wagon ( 326346 ) on Saturday September 23, 2017 @12:37AM (#55248913)

    Another story about the one-percenters.

  • AIDS is bad (Score:5, Interesting)

    by PopeRatzo ( 965947 ) on Saturday September 23, 2017 @12:42AM (#55248917) Journal

    I know a couple of people who have lived for decades with HIV. Both are hemophiliacs and got the virus before there was testing of the blood supply. They both lived in the same region of the US and caught the virus about the same time. They have to take tons of medicines to stay alive and they're already being treated for hemophilia, so it sucks for them. If they can finally get cured, that would be great. They're really good people.

    It sounds like this new antibody works a little bit like the various treatments they have for Hepatitis C. There are multiple genotypes of HepC and not all the drugs work for all the genotypes, but the medicines interfere with some protein or something and causes the HepC virus to not be able to "hide" from the immune system and it just ends up getting killed off. Completely. A disease that until 2014 couldn't be cured now has a treatment that is 90% effective. One pill a day for 12 to 24 weeks and virtually no side effects. And done. Cure. Completely. Unfortunately it costs like a quarter-million dollars so insurance companies won't let you have the treatment without a fight. They will first say no unless you have at least Stage 4 fibrosis (the stage before your liver starts dying), and then they make you jump through hoops and get multiple blood tests and ultrasounds and sometimes even liver needle biopsies (which actually damage the liver). Then, they'll deny you one more time hoping to run out the clock until you die. But if you have a good GI doctor, he'll go to bat for you and keep sending the prescription until it gets approved.

    To give you an idea how stupid our insurance-based system is, it's not even the insurance company that's denying you. It's a company that the insurance company hires called a "Pharmacy Benefits Manager" who are even harder to deal with than the insurance company. Then, they'll do completely random things like force you to use a different specialty pharmacy to get the meds (because you can't get these meds at your regular Walgreens, you have to go through a specialty pharmacy who will deliver the drugs to you, because every bottle of 30 pills is worth like $60,000. It's all really stupid. In Canada, the treatment is a small fraction of the cost. In India, it costs about $400 (but medical tourism doesn't work because the pharma companies have cut a deal with the Indian government to require people to show an Indian passport before they can receive the medication).

    I know all this because a musician I play with on a regular basis had HepC. He was getting sicker and sicker and my wife and I helped him a lot dealing with the insurance companies and pharmacy benefits managers and special pharmacies. The freaking medicine acted remarkably fast. Within 4 weeks, a guy who had been positive for HepC for 25 years was coming up negative for the virus on his blood tests. He felt better after only a few weeks. After 24 weeks, he was done. After another few months, he was tested, still negative. Since the liver regenerates, within 8 months, his fibrosis had gone from level 4 to level 3 to 2 and is now at level 1. Yes, it cost the insurance company a couple hundred grand (although it really didn't because the pharma companies make special deals with them where it only really costs a few grand) but it's still a LOT less than a liver transplant, which he would have needed eventually, or liver cancer treatment, which sucks really bad.

    I'm sorry to write this long story, but a cure is a cure. I hope eventually they can cure HIV as easily as they can now cure HCV. And if you're a baby boomer or Gen Xer, you should get tested for HepC the next time you get blood drawn. You don't want to wait until your symptomatic to find out you got it.

    • Maybe now they'll include hepc in standard testing. They haven't because there was nothing to be done about it
    • by Cyberax ( 705495 ) on Saturday September 23, 2017 @03:05AM (#55249135)
      The major problem with HIV is that it's a retrovirus. It inserts itself into the DNA of immune cells and then stays dormant (sometimes for years) until the cells are stressed, so simply clearing the virus from blood plasma is not enough. Modern anti-retrovirals can eliminate every single live virus particle but they can't touch the reservoir of dormant virus.

      Scientists are now looking at various gene-editing tools to get after it, like RNAi- or CRISPR-based therapies. It's not easy because the virus mutates easily but there's some hope.
      • by Anonymous Coward
        If you have a constant supply of these antibodies though, wouldn't they render the dormant HIV moot?
        • by emil ( 695 ) on Saturday September 23, 2017 @10:36AM (#55250215)
          No. Very few people ("long term non-progressors") create effective antibodies that can successfully control the infection. These new antibodies are actually tweaked and did not emerge from any person. The antibodies are manufactured and shipped for injection, and they must be refrigerated. Assuming they are human-derrived, they will last in the blood for a month. These are likely "monoclonal antibodies," and drugs that use this technique have names that usually end in -MAB. They're quite expensive.
      • The major problem with HIV is that it's a retrovirus.

        HCV, like HIV is an RNA virus. HCV can also stay dormant for decades. They used to think that HCV only attacked liver cells, but now they're learning it can "hide" in other organs and structures.

        The difference between a retrovirus and flavivirus is less than you think.

        • by Cyberax ( 705495 )
          HCV is not capable of true dormancy, it's either infective or not. "Dormant" period simply means that the immune system and the HCV virus are at a stalemate ( http://www.nature.com/nm/journ... [nature.com] ). It happens because the HCV virus has unusually low activity inside infected cells, a typical virus replicates itself furiously and causes cells to lyse (explode) quickly but HCV only produces around 50 copies of virus per day. So you can have situation where a fairly small amount of viral particles in blood are ef
          • Thanks, I didn't know all of that. Does this also have something to do with HCV's ability to "hide" in organs other than the liver? I've been active with the American Liver Foundation and I'm hearing that doctors are starting to prescribe the anti-HCV drugs for longer terms than originally prescribed, as well as combining drugs (like Sovaldi and Daklinza) because of this "stickiness".

            • by Cyberax ( 705495 )
              HCV apparently sometimes infects other cell types, but the same behavior applies - it still can't be truly dormant. It's possible that the existing drugs are not as effective for them. Several HEPC drugs are also prodrugs, so it's possible that other cell types don't metabolize them as efficiently.

              I'm an investor in a private company that is developing HCV and Zika treatments, so I have more than usual familiarity with these topics.
    • Indian government may be in cahoots with the pharma companies. But Indian people will help you

      Find an Indian friend who does not have HepC who will get his physician to prescribe that HepC meds for him and he will hand them over to you. Some will do it out of kindness and lot more will do it for a little baksheesh.

      Work with the system at personal level. Fight it collectively.

    • If you have an illness like this, fly to Europe and exploit the european system.
      You get treatment and they sue the american health insurance to get the money back (if they don't comply voluntarily).

  • We're improving... (Score:1, Interesting)

    by hyades1 ( 1149581 )

    So the first reports of AIDS started coming in a bit over 30 years ago. Ever since it was identified, and linked strongly with homosexual males, we've heard one preacher, imam and rabbi after another tell us how AIDS is a punishment from god visited upon a segment of humanity that richly deserves to die.

    Well, I guess we've got some bad news for god. In just two generations...less time than a lot of the punishments god metes out (remember "even unto the third generation"?), we've pretty much got AIDS under

  • Cure for HIV??? (Score:2, Interesting)

    by jez9999 ( 618189 )

    If these guys cure HIV they must surely get the Nobel prize for medicine.

  • This is about the 10th time they've cured AIDS/HIV just in Slashdot's reporting. This is solar panel and battery efficiency all over again. I think both are at about 105% efficiency cumulatively. Why is HIV still a thing now?
    • A function can be increasing but bounded : 1-1/x for example.
      It means that solar panel efficiency can always keep on improving while still being stuck below 50% forever. No need to achieve 105% ;)

    • Because they had milked the Transparent Aluminum threads a decade ago.

      • by MercTech ( 46455 )

        Transparent aluminum? Isn't that called "sapphire"?
        Oh, you want it both transparent and ductile? Good luck.

  • Fundamentalist Christians are going to be pissed! http://www.rightwingwatch.org/... [rightwingwatch.org]

    God will now not only punish them there Qeeeayars, but the people who took away God's divine and loving punishment for them.

    But seriously, this is pretty good news.

BYTE editors are people who separate the wheat from the chaff, and then carefully print the chaff.

Working...