Forgot your password?
typodupeerror
Science News

Gene Found That May Affect IQ in Males 660

Chowser writes to tell us the AZStarNet is running an article stating that North Carolina scientists claim to have identified a gene that affects IQ in males. The difference is apparently quite striking, with the average IQ difference between those that had the gene and those that didn't being approximately 20 points. From the article: "However, he stressed that the IQ results in his research were based on a group average; individual males carrying the gene version had a wide range of IQ scores. While females also can carry the variation, it does not appear to affect their IQ, he said."
This discussion has been archived. No new comments can be posted.

Gene Found That May Affect IQ in Males

Comments Filter:
  • Company looking for a web designer with the proper IQ gene to design a website compatible with firefox, some javascript knowledge also required.
    • I think that it would be cheaper and easier to administer an IQ test than a genetic one, plus, if the IQ test already exists, why isn't it required for job interviews.

      Cheers,
      Adolfo
      • Because actually being physically and mentally capable to perform tasks associated with a job can't be a job requirement anymore. Now, if we get rid of OSHA, we can keep the non-discriminatory policies and let natural selection weed out the bad ones like we did in the 20s ...
        • Do you know what the bad ones who get "weeded out" under such a system do when they can't find a job? They steal your car and sell cocaine in order to get by.

          Even the strictest of libertarians will agree that it's better to have a system in place that gives such people something productive to do. Sure, they don't have the IQ to design bridges or perhaps even to work a cash register. Nevertheless, society as a whole is better off if there are opportunities available to those who cannot compete in the job mar
          • by Velox_SwiftFox ( 57902 ) on Wednesday December 07, 2005 @01:14AM (#14199863)
            Oh, that would be wonderful. An incentive for clever people to take up a life of crime. I think you had better refigure this. Let's watch out for seemingly smart people who do not seem to be able to find a job, and employ them, before they find out they might be smarter than the person investigating their prospective crimes.

            Or just keep a close eye on them, at least.
            • by werewolf1031 ( 869837 ) on Wednesday December 07, 2005 @10:44AM (#14201894)
              Yeah, great idea. "Hey, that guy's smarter than most of us, which means he's a potential threat to society, therefore we should keep very close tabs on him even though he's done nothing wrong , we're just pretty sure he will eventually, because... well, he can."

              Hey, better yet, why not just preemtively lock up anyone with a sufficiently above-average IQ? After all, they're capable of far more than the average "sheeple", certainly more so than the average police officer or federal investigator (percieved as his "natural enemies" just because he's capable of outsmarting them, nevermind whether he would actually try), and worst of all these intelligent folks tend to question established norms that should never be questioned (eg. laws, rules of behavior, patterns of thinking, etc.).

              A friend of mine once made the observation that having a working brain in a society that values everything except intelligence is almost like having a real superpower. Yes, it means that smart people can do things that the majority of people can't. However, as parent so sadly illustrated, it also makes them a target, for the very same reason. The average person fears what they don't understand, and they don't understand people that possess greater mental faculties than themselves.

              And before anyone flames me too harshly, bear in mind that I'm not suggesting any kind of "superiority" of intelligent people -- human nature and failing knows no IQ score. I'm just pointing out the absurdity of fearing someone, of suspecting them to be of greater criminal inclination, than those of average (or lower) intellect. To associate one's predisposition to commit crime or harm others as being directly proportionate to intellectual capacity a "because they're smart enough to get away with it" is beyond asinine.

          • by WoodstockJeff ( 568111 ) on Wednesday December 07, 2005 @02:31AM (#14200166) Homepage
            But, who could afford it, given today's laws and taxes? Under current law, it costs an employer a minimum of about $500/week (depending upon the state) to employ a person for 40 hours at minimum wage. That's not what the employee gets - that's what it costs the employer to have them around. Anyone that doesn't produce at least $500/week in value to the business isn't going to be around for very long, no matter how "compassionate" it is to keep them.

            One of the local businesses used to hire students on summer vacation for clean-up of the property and shop. Few skills required, good hours, etc. But, once the minimum wage got over $3/hour, it was less expensive for the owners to do that work themselves. No more low-skill jobs there, and no chance to get your foot in the door for the high-skill, high-paying jobs in the rest of the plant.

            There are jobs out there that do not require a lot of skill. Several million of them, according to statistics on illegal immigration. The trick is convincing students that they're not worth $30K per year when they first leave high school, because they haven't proven themselves in the work place. And that low-skill jobs aren't a career, but are a stepping stone toward better jobs. You're not going to stay a hamburger flipper, unless you have no ambition to move on... or your ambition is to own a hamburger joint!

            • by C10H14N2 ( 640033 ) on Wednesday December 07, 2005 @04:24AM (#14200466)
              Erm, the minimum wage has been over $3/hr for TWENTY-FIVE !@#%ING YEARS, BUDDY.

              Now, then, going on that logic, if the owners of a business were making so little money that $3/hour was so much that their own labor was worth less, I hardly would fault the wage-earner in that equation as much as the "business" (read: lack of) owner...

              In 1980, when the minimum wage exceeded $3/hour, my family business--running out of, basically, our freaking garage--paid our employees $40k/year. Yeah, the minimum wage really got in the way.

              People who bitch about the minimum wage betray their utter ignorance of basic high-school level economics.
              • I'm afraid it is you who is demonstrating total ignorance of economics. The decision to hire a candidate is not based on how much money is earned by the business as a whole, it is determined by how productive that individual is. If the individual cannot produce more than his wage, no matter how much money the company is making it does not make sense to hire him. Minumium wage laws make it more difficult for people who are unable to be very productive to get jobs. Why would you hire someone at 3$/hr when
            • by michaelhood ( 667393 ) on Wednesday December 07, 2005 @04:53AM (#14200544)
              what does low-skill jobs have to do with illegal immigration? i live in socal, and most of the border jumpers are more competent in every single area (bar English) than their counterparts around here. i'm in favor of stricter border laws, but these people had the initiative to go on one hell of a journey to better themselves. you can't convince most orange county kids to do anything. they want, and expect, everything handed to them.
            • "And that low-skill jobs aren't a career, but are a stepping stone toward better jobs. You're not going to stay a hamburger flipper, unless you have no ambition to move on... or your ambition is to own a hamburger joint!"

              The whole thing is about IQ, low IQ people are quite often desperate to reach the level of "hamberger flipper". It rarely has anything to do with money, usually they want acceptance and TO BE USEFULL. A bussiness that gripes about the minimum wage is not worth working for, either for mon
          • it's better to have a system in place that gives such people something productive to do

            You mean like Telephone Sanitizers, Management Consultants, and hairdressers? :o)
    • Or perhaps it's time to use a better browser. Konqueror and Opera both render that site just fine.

  • by ReformedExCon ( 897248 ) <reformed.excon@gmail.com> on Wednesday December 07, 2005 @12:29AM (#14199648)
    It would be very interesting to see the effects of this gene across different populations. If it does not adversely affect Caucasian females, perhaps other populations are also immune to its effects (or are particularly susceptible to it).
    • It said whiLe females... not whiTe females...
      • From the article:

        The researchers studied about 300 children with an average age of 10. The children, all Caucasian, came from six counties in the Cleveland area. As a group, males -- but not females -- who had the variant gene had IQ scores about 20 points lower than males who didn't.

        It would be interesting to know if the same findings hold true in older populations; it may be that the gene only affects the rate at which the brain develops, not its eventual capabilities.

    • Firstly, the article (and /. blurb) says females in general, not specificaly Caucasian ones. It's fairly well known that a lot of genes relating to nervous system development are X-linked, in some work by my colleagues looking at sleep and IQ, this is something that is controlled for by considering the mother's IQ. I would be interested if there were any variations with race, however. At a conference I'm just about to fly back from, one of the talks detailed how one metabolic mutation was carried by 10% of
      • by Anonymous Coward
        Am I the retarded person here? Here is a direct quote from the article:

        The researchers studied about 300 children with an average age of 10. The children, all Caucasian, came from six counties in the Cleveland area.

        Now, if you can tell me how the hell you figure that the females were anything but Caucasian, I'd really appreciate it. Perhaps I'm just a dumbfuck with this specific gene and my 20 point IQ gap is causing me to misunderstand "The children, all Caucasian".
    • Every biological discovery "may lead to new breakthroughs in aging/cancer/AIDs/impotency treatment", yet so few do.
      Every space probe/Hubble/whatever "may tell us about the origins of life/the universe", but we've really got no closer to the answers. Even mars (now looking like a rover junkyard) "may have sub surface water".

      C'mon scientists, stop hyping. Call us when you've got something real to show. Unfortunately I think the hyping is an inevitable part of trying to rake up funding. Headlines-->good PR-

    • by penguinoid ( 724646 ) on Wednesday December 07, 2005 @01:35AM (#14199946) Homepage Journal
      Various genetic disorders can be carried by females, but only manifest in males. I guess we have this to compensate. I wonder how many other positive genes manifest only in males?
      • I wonder how many other positive genes manifest only in males?

        The main one is technically called "The Power of the Pole"

        Use it wisely, my son.
      • by BerntB ( 584621 ) on Wednesday December 07, 2005 @06:44AM (#14200800)
        I guess we have this to compensate. I wonder how many other positive genes manifest only in males?
        Anyone with a teeny bit of biology knowledge can tell you that it doesn't work that way.

        Start with Googling for a definition of allele, to understand the concept.

        If some gene-dependent trait is "positive" or not depends upon the environment. (See e.g. malaria resistance and red blood cells.)

        In general, there are two things influencing wether a trait is on for males/females.

        • Males only get one copy of the genes on the X chromosome, so a non-dominant trait shows up easily because there is only one copy (e.g. colour blindness).
        • Also, genes are often regulated differently for between males/females (i.e. what genes are on or not).
    • by paulsgre ( 890463 ) on Wednesday December 07, 2005 @02:25AM (#14200144)
      I agree that looking at other populations is crucial, but from what I can tell, they haven't even determined whether this is the gene actually responsible for the observed correlation.

      1. When looking at haplotypes, we see that genes travel together in chunks, and because someone has an alternate version of this gene, it could just mean that the haplotype is different. For example say the top 1/3 of chromosome #3 has 7 haplotypes. This means that when you look at populations from all over the world, you will see one of these 7 haplotypes, with 2-3 occuring in the vast majority of cases. On this haplotype there are multiple genes that travel together and recombine together so taht they stay "linked". The gene ACTUALLY affecting IQ could merely be closely linked in physical proximity to the gene they have identified. The genotypes observed in this study may just be markers for another as yet unidentified gene.

      2. The fact that it affects caucasian males vs females suggest it is sex-linked and other populations with the gene would be similarly affected. HOWEVER, it is entirely possible that the observed gene is an uncommon phenotype that has not drifted throughout the species and doesn't even exist in other races/populations.

      3. The gene in question codes for a growth factor receptor. Growth factor temporal expression dynamics are an interesting but complex subject, and the fact that they are looking only at 10 year olds presents another major problem. In brain development (or any development), decreased affinity for a ligand can alter the protein-binding curve such that more of the ligand (in this case the insulin-like growth factor) is needed to elicit the desired response, OR the ligand may fail to elicit the response because it "missed the train". There are different types of latencies across individuals, and increased developmental latency is a hallmark of the evolutionary nascent human brain, so it would not surprise me that there are many genetic variants of brain growth factors and receptors expressed during adolescence. Let's put it this way- there are two types of "malfunction"- A)you're supposed to meet up with your friends at 9 but you arrive at 10pm- your friends are pissed at you, but they waited for you, and the drunken revelry can continue as planned OR B) your flight was at 9pm, you missed it, too bad, do not pass go and do not collect 200 dollars.
      In the case of this growth factor receptor, we have no idea whether the gene variant causes malfunction, slower reaction, or complete inactivation, or even increased activation. I would not be surprised if the observed IQ differences leveled out over the next 5 years, especially considering the sex-hormone charged brain differentation that occurs during puberty.

      This article is pop fluff, and I would be wary of drawing any sort of conclusion from it.
    • No you don't understand. They put the population with the gene in with the women. All male IQs go down by the amount they observed when they're placed next to females. Females do this too but only for the males they find attractive. Trouble is most males find any female attractive.

  • Sample size? (Score:5, Informative)

    by Majik Sheff ( 930627 ) on Wednesday December 07, 2005 @12:31AM (#14199656) Journal
    300 10-year-olds from neighboring areas? Any variation in a sample that size is just signal noise. The genetic->IQ link has always been a contentious subject... This is only fuel for the fire.
    • Re:Sample size? (Score:3, Insightful)

      by tomzyk ( 158497 )
      Any variation in a sample that size is just signal noise.
      Normally, I'd agree... but in this situation (when talking about IQs), I think 20 points is a VERY significant amount.

      I would, however, be more interested in which counties these children were from. This could just be a difference in upbringing and education rather than genetic.
      • It _would_ be interesting if this gene was correlated with the upbringing as you suggested. If your father had this gene you may be more likely to be in a poorer environment for reversing the effects this gene would have on your IQ. So, it could have a negative feedback response on you progreny which would accumulate over time. This might account for the significant difference between the two groups (the difference grew over generations). This might also account for why there was a wide variation in IQ
    • The necessary sample size is determined by the population parameters. 300 may or may not be a large enough sample; anyone know offhand what the population variance for IQ is?
      • by Dire Bonobo ( 812883 ) on Wednesday December 07, 2005 @01:00AM (#14199802)
        > anyone know offhand what the population variance for IQ is?

        The standard deviation of IQ is 15 or 16 [wikipedia.org] in most scales. A difference of 1.25 standard deviations is not small.

        However, without knowing the frequency of the gene in the tested population, it's impossible to know if the difference is statistically significant. If the group was 50% male and 50% had the gene, it almost certainly represents a real difference; if only 5% had the gene, that's only 7-8 guys, and the "difference" is pretty likely to be random chance.

        It's also worth noting that the difference could be in developmental speed rather than in level---i.e., the guys with the gene could just take longer to develop, but be just as smart by age 25, or could be associated with some other factor that is merely correlated with intelligence (such as, say, alcoholism which can lead to poverty which can lead to a less intellectually-nurturing home life).


        Basically, this article gives us a sound bite with almost no useful information---shoddy reporting.

    • Re:Sample size? (Score:5, Informative)

      by bcrowell ( 177657 ) on Wednesday December 07, 2005 @12:57AM (#14199784) Homepage
      It's impossible to tell the signal-to-noise ratio from the info given in the article, because they don't say how frequent the gene is. If the gene has a 50% frequency, then the number of people with the gene in their study is 150, and the number without is 150. IQ is defined to have a mean of 100 and a standard deviation of 16. Averaging over a group of 150 people reduces the s.d. by a factor of 1/sqrt(150), to 1.3, in which case a 20-point difference between the two groups is extremely statistically significant. However, if the gene has a very high or very low frequency, then one of the two groups could be very small, in which case it might not be significant.

      They also don't say how they controlled for other variables. For instance, IQ is highly correlated with socioeconomic status, and if they didn't control for that, then that could explain the whole effect. E.g., black hair is negatively correlated with socioeconomic status in the U.S. (all those impoverished African-American and Latino people have black hair), so it's negatively correlated with IQ, but that doesn't mean that the gene for black hair also causes you to be stupid -- it just means that, for various reasons, IQ tests are biased against African-American and Latino people.

      • IGF2R (Score:5, Informative)

        by MillionthMonkey ( 240664 ) on Wednesday December 07, 2005 @04:42AM (#14200520)
        According to build 35.1 of GenBank and version 124 of dbSNP, the following 66 genetic polymorphisms have been found to occur within the 48 exons of IGF2R in humans:

        rs_number|alleles|position (on chromosome 6)
        rs8191692 C/T 160360652
        rs2975115 C/G 160360684
        rs2975116 C/G 160360687
        rs8191704 A/G 160382749
        rs11759563 C/T 160416104
        rs8191746 C/T 160416109
        rs8191753 A/G 160418673
        rs8191754 C/G 160418735
        rs8191758 A/G 160421034
        rs8191763 C/T 160424152
        rs1570070 A/G 160424389
        rs13198308 C/T 160432052
        rs8191776 A/C 160434644
        rs6413489 A/G 160434696
        rs894817 A/G 160434700
        rs8191797 A/G 160437232
        rs1050004 A/G 160437257
        rs8191798 A/G 160437267
        rs998075 C/T -160438689
        rs6413491 A/G 160438720
        rs8191808 C/G 160439921
        rs8191809 A/G 160439953
        rs8191810 A/G 160439956
        rs8191819 A/G 160441967
        rs8191820 C/T 160441987
        rs8191840 C/T 160452138
        rs8191842 C/T 160453003
        rs8191843 A/G 160453053
        rs8191844 C/G 160453340
        rs2274850 C/G 160450541
        rs2230043 A/C 160454948
        rs8191859 A/G 160455901
        rs8191860 A/G 160455961
        rs2230048 A/T 160459759
        rs8191869 A/G 160459815
        rs8191881 C/T 160463358
        rs8191886 A/G 160464245
        rs2230044 A/G 160464245
        rs629849 A/G 160464820
        rs11552587 C/T -160465339
        rs1050005 C/G 160465360
        rs8191904 A/G 160471039
        rs8191905 A/G 160471123
        rs8191906 C/T 160471223
        rs8191908 A/G 160471609
        rs2230049 C/T 160471684
        rs614754 C/G -160475610
        rs1805075 A/G 160475618
        rs8191933 C/T 160487883
        rs3190229 C/T 160487892
        rs1803989 C/T 160487892
        rs8191955 C/T 160496427
        rs8191956 C/T 160496750
        rs8191957 C/T 160496859
        rs8191958 A/G 160496868
        rs8191959 A/G 160497049
        rs8191960 -/ACAC 160497143
        rs8191961 A/G 160497202
        rs3832385 -/TTTG -160497316
        rs8191962 -/ACAA 160497322
        rs8191963 C/T 160497586
        rs1050015 A/C 160497591
        rs8191964 C/T 160497662
        rs8191965 -/GCATGGCGTGGAGGAGGAGGGAGGCCGGGCGG 160497665
        rs8191966 A/G 160497672
        rs14531 G/T 160497919


        (Sorry about the formatting; the lameness filter forced me to make it look like that.)

        Here "C/T" in the alleles column means some people have C and other people have T. A minus sign indicates a deletion (the allele is an empty string). A negative position indicates that the reported alleles are relative to the compliment strand. (This happens if they get the strand wrong when they define it.)
        You can look up population data for these genetic variations by rs number (sometimes categorized by distinct racial groups) at dbSNP. [nih.gov] The locus in question is either one of these 66, or else the "smart/dumb" gene is a splice variant which is also likely- one of the versions has an exon that the other doesn't- which would mean that the locus is in a promoter region in one of the 47 introns. There are 603 variations in the introns. That would never get past the lameness filter.

        The popularized crap on Google News is useless. I did a search on Google Scholar for "IGF2R Jirtle IQ" and found this:

        Interestingly, M6P/IGF2R in mice is imprinted in all tissues except for the brain where both alleles are expressed. It is highly expressed in neurons of the forebrain, with the highest expression in the pyramidal cells, the polymorphic layers of the hippocampus, and the granule cell layer of the dentate gyrus; regions involved in emotional behavior, information processing, and memory formation. These findings indicate that M6P/IGF2R may assist in the development of these brain functions. This postulate is reinforced by the identification of M6P/IGF2R as the first putative "IQ gene." By comparing children with an IQ of 160 or higher to those with an average IQ, M6P/IGF2R was shown to be linked with general cognitive ability ("g"). The role of this receptor in the development of cognitive function can now be systematically assessed with M6P/IGF2R conditional knockout mice.

        Tissue-Specific Inactivation of Muri

      • Re:Sample size? (Score:3, Insightful)

        by Hognoxious ( 631665 )
        it just means that, for various reasons, IQ tests are biased against African-American and Latino people.
        Total non sequitur. It may in fact be the case that they are less intelligent (or just less "test-smart") than whites. Heck, they just might not be interested or motivated.

        Asians usually have black hair, too. Remind me, how do they generally score on standardised tests?

    • You seem to lack a feel for statistics. With surprisingly small samples, you can get pretty solid numbers.

      The standard deviation for IQ is usually defined to be 15 or 16. (rarely, it may be 20)
    • He's not talking about the number of subjects compared to the apparent IQ delta. He's talking about the number of subjects compared to the number of candidate genes to effect such a change. The study could very well have selected for noise.
  • Gattaca (Score:4, Funny)

    by mrchaotica ( 681592 ) on Wednesday December 07, 2005 @12:31AM (#14199658)
    So, now where can I get a genetic evaluation for my girlfriend and I, so we know if we'd risk passing this gene on to our children? Or, alternatively, when will we be able to genetically engineer them not to have it?
    • Better still, let's develop ways to artificially increase everyone's IQ!
    • Re:Gattaca (Score:5, Funny)

      by dogwelder99 ( 896835 ) on Wednesday December 07, 2005 @12:56AM (#14199780)
      Well, I already know I don't have the dumbness gene, because my IQ isn't 20 points lower than it is. Or something.
  • maybe... (Score:3, Funny)

    by rd4tech ( 711615 ) * on Wednesday December 07, 2005 @12:33AM (#14199671)
    Maybe they have actually found the male-dumbness gene?
  • Housekeeping... (Score:4, Insightful)

    by Chemical Serenity ( 1324 ) on Wednesday December 07, 2005 @12:34AM (#14199677) Homepage Journal
    "...didn't being marked at 20 approximately 20 points."

    Maybe I have that gene, 'cuz I can't figure out what you're trying to say there... ;)
    • Re:Housekeeping... (Score:2, Informative)

      by strider44 ( 650833 )
      The difference is apparently quite striking with the average IQ difference between those that had the gene and those that didn't being marked at 20 approximately 20 points.

      I think that is actually gramatically correct, but missing a couple of commas or brackets to make things more readable:

      The difference is apparently quite striking with the average IQ difference between those that had the gene and those that didn't being, marked at 20, approximately 20 points.
    • It's a sad state of affairs when the editors don't either fix it or ask the author to fix it.
      Where's a <sic> when it needs one?
    • by Epistax ( 544591 )
      What's there not to understand? At 20 years old the difference was 20 points. If that's not what he meant, I'm completely backwards in English.
  • by Dr. Eggman ( 932300 ) on Wednesday December 07, 2005 @12:38AM (#14199697)
    IQ tests are too unreliable for identifying gene that contribute to intelligence. They are far from standardized for all people/genders and until then its really not possible to definitivly say just how any gene affects intelligence short of extremely major differences, such as those found in cases of genetic disorders. Even then, determining the exact gene (if it even is just one) is very difficult. If only we could agree on a perfect definition of intelligence first, then maybe we could come up with a better way to measure it.
    • by r00t ( 33219 ) on Wednesday December 07, 2005 @01:10AM (#14199850) Journal
      Normal IQ tests designed by different groups show similar results when you give people both tests. People who get high scores are the people we commonly think of as being "smart", "intelligent", or "brainy". So obviously the tests work pretty well.

      Sure, the tests will never be perfect. That doesn't make them useless or irrelevant.

      Unless you're an idiot-savant, splitting hairs about different types of intelligence isn't all that useful. Unless you were raised by wolves in a cave, whining about cultural biases is just plain whining.

      BTW, 20 points could qualify as "extremely major differences".
      • by RodgerDodger ( 575834 ) on Wednesday December 07, 2005 @02:30AM (#14200163)
        If you can get a high score on an IQ test, then yes, you're probably "smart", "intelligent" or "brainy". But a low IQ score doesn't mean you are not, either. That's the problem with them - all the false negatives.
      • by mosb1000 ( 710161 ) <mosb1000@mac.com> on Wednesday December 07, 2005 @09:08AM (#14201245)
        The thing that I think is really funny about IQ tests is that they correlate well to academic ability, but seem to be unrelated to the real-world success of the individuals tested. If they don't relate to ones actual ability to be a productive member of society, it's hard to argue that they're meaningful.
        • by Surt ( 22457 )
          Maybe the smarter you are the less interested you are in being a society drone all your life. Hence the lack of correspondence on that scale.

          A more interesting question might be: how well does it correspond to the multi generational success of your genetics.
        • The thing that I think is really funny about IQ tests is that they correlate well to academic ability, but seem to be unrelated to the real-world success of the individuals tested. If they don't relate to ones actual ability to be a productive member of society, it's hard to argue that they're meaningful.

          Fortunately, in the real world people are actually doing research on this and not just speculating.

          Taken from http://en.wikipedia.org/wiki/Intelligence_quotient [wikipedia.org]:

          Research shows that intelligence plays an im
    • Everyone knows that IQ tests don't tests all types of intelligence, but I don't see how that makes these test results meaningless. Perhaps this gene is of benifit to males with other types of intelligence?
    • IQ tests are too unreliable for identifying gene that contribute to intelligence.

      Yes, yes.. That's very PC and all, but it looks like THAT gene does play a significant role.

      From here [kansascity.com]

      Jirtle said his assertion that the IGF2R gene affects IQ is bolstered by experiments in mice. When he and his colleagues disabled a copy of the gene in lab mice - an experiment intended to mimic humans who inherit the variant copy of the gene - they noticed that the male mice were slow learners on a maze test. Electrical

  • uhhhh.... (Score:3, Insightful)

    by Tumbleweed ( 3706 ) on Wednesday December 07, 2005 @12:40AM (#14199703)
    ...what?
  • p=? (Score:3, Insightful)

    by wpegden ( 931091 ) on Wednesday December 07, 2005 @12:42AM (#14199712)
    I'll wait to see their statistics. Why did they study this gene? It seems likely, for example, that given any group of 300 people, one could find a gene variant correlated with higher (or lower) IQ *in those 300 people*. With 30,000 genes, the statistics could be quite delicate. Another subject not discussed, apparently, is that a gene could presumably affect rate of development or growth, rather than eventual intelligence (this may be much more plausible, for example). This would manifest itself in 10-year olds, but not, for example, in 30 year olds. Why did they study 10-year olds? It seems like this may be an obvious objection.
  • It's called the beer gene, I thought everyone knew about that one?
  • So I don't have to run around trying to do complicated crap. Seriously, if I knew what my limits or capabilities are, I could work with 'em instead of doing things the wrong way. For example, maybe I wouldn't have bothered taking calculus and done something else instead.
  • by joey_knisch ( 804995 ) on Wednesday December 07, 2005 @12:43AM (#14199717)
    welcome our new male overloards... Oh wait...
  • uhmmmm were the men that inherited this gene blond haired?
  • If it's that simple, sign me up for a six-pack. Thanks!
  • The difference is apparently quite striking with the average IQ difference between those that had the gene and those that didn't being marked at 20 approximately 20 points.

    Well now we know who doesn't have the IQ gene...
  • by catdevnull ( 531283 ) on Wednesday December 07, 2005 @12:59AM (#14199797)
    The study went on to find that those individuals without this gene tend:

    - to be picked as moderators on slashdot...
    - to vote straight party tickets
    - to claim that "anal leakage" is an acceptable side-effect for food additives
    - to buy advanced copies of the Dukes of Hazzard DVD
    - to work on the MSIE team
    - to post stupid bogus study result lists on /.
    • Slashdot moderator says: "-1, Truth Hurts"
    • Re:Related Traits... (Score:4, Interesting)

      by meringuoid ( 568297 ) on Wednesday December 07, 2005 @06:10AM (#14200718)
      - to be picked as moderators on slashdot...

      I usually get moderator points quite frequently - normally, it's when I've just done some metamoderating, a duty I confess I often ignore. However, I don't really use them for anything.

      The problem with having modpoints is that, if a discussion is on a topic I know something about, or at least that I care about, then I'd far rather post replies than moderate. So I end up making use of my modpoints by going into discussions I neither know nor care about and shooting down First Posts, GNAAs, goatses and copy-paste trolls...

      This may be why we've developed this stereotype of moderators as clueless. If they knew about the stuff being discussed, they'd be discussing, not moderating - so just like I always do, they've gone into a discussion they care little for and are doing the best they can there.

  • by bigberk ( 547360 ) <bigberk@users.pc9.org> on Wednesday December 07, 2005 @01:02AM (#14199807)
    Yes some people definitely have, genetically, an intellectual advantage over others... but as I've grown older I have reluctantly acknowledged how other kinds of smarts -- notably, common sense and street smarts -- are really more important.

    Let's say you're a genius, some child prodigy who's super at calculus or something.

    Can you charm women and get laid?

    Can you get along with strangers and keep a stable job?

    Are you smart enough to stay out of trouble? Avoid fights, etc.

    Are you smart enough to choose good friends?

    Are you disciplined enough to manage our finances?

    Are you street smart enough to protect your wealth from crooks?

    Do you get regular exercise and stay in shape?

    These are all things that are very important for a good quality of life, and you don't necessarily get 'em just because you are smrt.
    • Let's say you're a genius, some child prodigy who's super at calculus or something.

      Can you charm women and get laid?


      Given this is number one on your list of things I'd hazard a guess that you:
      a) Are desperate
      b) Don't have any understanding of how to relate to women
      c) Not all that smart

      There's more to life than getting laid. Even when you're not getting any it shouldn't be number one on your priority list!
  • by strider44 ( 650833 ) on Wednesday December 07, 2005 @01:06AM (#14199828)
    "All men are created equal, except for those guys."
  • by CyricZ ( 887944 ) on Wednesday December 07, 2005 @01:09AM (#14199844)
    Does anyone have any information regarding who funded this research?

  • If so...so what? (Score:5, Insightful)

    by bcrowell ( 177657 ) on Wednesday December 07, 2005 @01:18AM (#14199882) Homepage
    Why would this be interesting, if it was true? Any trait is determined by some combination of (1) genetics, (2) prenatal environment, and (3) environment after birth. Studies of twins have already shown that genetics accounts for a very large percentage of the variance in IQ scores. On the other hand, there is no consensus about what IQ scores measure, except that they measure...the property possessed by people who do well on IQ scores. So we already knew there are genes that are important in determining it, but we don't know what "it" really is. What does this particular study (if correct) tell us that we didn't already know?
  • by Anonymous Coward
    It is very interesting that this gene only seems to be expressed in males. I wonder what the result would be if they tested the effect of this gene in gay people? Would they score more like straight males (- 20 points) or females (no difference)?

    If the gene doesn't affect gays, it might provide some explanation for why an apparently genetic trait that limits reproductive success (homosexuality) nevertheless seems to be present in a significant percentage of the population.

    Mod me troll for this if you want
  • Most probably the reason that that " females also can carry the variation, [and] it does not appear to affect their IQ" is that females carry two mostly different X chromosomes and therefor have a backup for any defective gene, while men have only one X chromosome plus some dumb little Y chromosome that encodes our dicks and little else.

    If they knew what they were talking about they'd ask whether a women with TWO of this gene had a lower IQ just like a man with one.

    Probably they do, but also, no doubt, they
  • Correlation? (Score:5, Insightful)

    by erikharrison ( 633719 ) on Wednesday December 07, 2005 @01:37AM (#14199950)
    Let's not forget what we are testing for here. We're not saying that this gene makes people dumb. We're saying that boys with this gene score more poorly than boys without this gene. We're using a purely operational definition of intelligence (IQ score), and not making a value judgement.

    This is interesting science, despite those who are spending their energy railing against IQ tests. IQ tests are terrible indicators of how "bright" someone is, but they are fairly consistent tests, in which people tend to get the same results over time, so they are measuring something with accuracy. And whatever that is, is hurt by this gene.

    Is it attention? Does this gene make your balls itch, thus distracting you from standardized tests (also explaining why it only affects boys)? Perhaps, does it affect mathematico-spatial ability specifically, which boys tend to do better on than girls (very likely for social reasons), and thus the generally poor performance of girls in this part of the test accounts for the gender variation (a floor effect)?

    Who knows. But a strong correlation between a gene and a standardized test score (especially a well established one like most IQ tests) in a not insignifigant sample (300 kids) is nothing to sneeze at - 20 points in a sample that large tends to indicate it's a real effect. Don't let the articles journalistic simplifications ("Gene makes boys dumb") throw you from seeing what that is.
    • Re:Correlation? (Score:3, Interesting)

      by X ( 1235 )
      One of the funniest bits of this article was on the subject of correlation:

      But so far, connections between IQ and specific genes have been just correlations, with little supporting evidence. The new research, Jirtle and other experts said, will need to be replicated before it is considered definitive.

      Unless there is something in the research that the article failed to capture, I don't see how this would amount to anything other than a correlation, as there isn't any evidence of the mechanism by which the ge
  • I thought that IQ tests had a margin of error of about 20 points. Can anyone confirm or deny this?
  • by Think Loudly ( 919383 ) on Wednesday December 07, 2005 @01:38AM (#14199957) Journal
    Instructions:
    Please read all instructions before beginning this test.
    For this test you'll need:
    • Two #2 sharpened pencils
    • A non recessive IQ gene
    • Four sheets of blank paper
    • etc...

    If you did not bring the proper pencils or paper, please see the administrator. If you lack the proper genes, please turn this test over and place your head down upon the table. Your test will be administered later; when we have time for you. If you cannot read this sentence, stare blankly out into space until somebody comes by to escort you away.
  • by craXORjack ( 726120 ) on Wednesday December 07, 2005 @01:44AM (#14199981)
    This explains that Simpsons episode when Lisa was depressed because she thinks she will turn out to be a loser, but then it turned out only the male Simpsons were like Homer and all the females were doctors and scientists.
  • by Chris Snook ( 872473 ) on Wednesday December 07, 2005 @02:08AM (#14200084)
    People are treating this like there's a "smart gene". That's not at all the case. All they've done is identify a genetic defect which tends to lower the IQ of people who have this defect. They don't know the mechanism, and they still have a wide range, so it's probably one of many factors that is meaningless in isolation. Testing a particular living person for it wouldn't tell you anything useful about their intelligence.

    So, what about potential people who do not yet have an intelligence that can be tested? Well, it turns out that IGF2R is a very, very special gene for other reasons. There are certain genes that are "imprinted" in sexual reproduction. You might wonder why, with all the mutations and screwups that nature seems to allow, we don't see female mammals occasionally giving birth to their own clones, from meiosis that doesn't go as planned. Well, inheriting two of the same chromosome is almost always fatal because of these imprinted genes. With imprinted genes, genes are expressed if and only if they come from one particular parent. IGF2 is expressed exclusively from the father. IGF2R is expressed exclusively from the mother. The upshot of this is that while you could use this to discriminate among egg donors, using it to discriminate among sperm donors would be useless. As the mechanism that causes the correllation is still unknown, and ova are in much shorter supply than sperm, people are unlikely to be terribly selective about it in ova. Given all the other things we can test for, it's unlikely people would make a sperm decision based on how smart the grandsons of their designer daughters would be. If we're assuming babies with pre-selected genetic makeup, the next generation could do the same, rendering the decision moot.

    Read more: http://users.rcn.com/jkimball.ma.ultranet/BiologyP ages/I/Imprinting.html [rcn.com]
  • by tezza ( 539307 ) on Wednesday December 07, 2005 @06:19AM (#14200736)
    Newest Geene Th3rapy Pills. Garanteeed to wqork. Ignore useless im1tatiuns.

    Never feel stoopud over the Dinner conversation. Solve Sudoku puzz in seconds.

    Most best source on the Net.

    100 Tablets £100
    200 Tablets £125
    300 Tablets £150

"It's the best thing since professional golfers on 'ludes." -- Rick Obidiah

Working...