
Mouse Genetic Code Published 51
linuxwrangler writes "Scientists in six countries have published a nearly-complete genetic code of the mouse. Results show striking similarities between human and mouse DNA and scientists are now working on side-beside mapping of the two genomes."
I know! I know! (Score:4, Funny)
Results show striking similarities between human and mouse DNA and scientists are now working on side-beside mapping of the two genomes
And the project is called "Of Mice and Men", right?
GMD
Re:I know! I know! (Score:4, Funny)
> And the project is called "Of Mice and Men", right?
more like "The Best laid plans of mice and men."
oooh, creepy.
The mice will be furious.
-metric
Re:I know! I know! (Score:2)
In other news... (Score:3, Funny)
Re:In other news... (Score:1)
Striking similarities. (Score:5, Insightful)
It's not that astounding that similarities in the genetic code should be found, or even striking ones.
Re:Striking similarities. (Score:1)
Not that I'm some vegan tree-hugger, but it's naive to rationalize our treatment of animals on the premise that we are somehow not "animal". Animals eat and kill other animals. People should just accept that.
Re:Striking similarities. (Score:1)
Re:Striking similarities. (Score:1)
Actually, I was watching something on Animal Planet (I think?) last night that featured the Grasshopper mouse, also known as the Scorpion mouse.
They primarily eat insects, particularly scorpions, and other small rodents, sometimes including each other... That's right... Cannibals.
Here's some links:
The Carnivorous Grasshopper Mouse [wcsscience.com]
Tulare Grasshopper Mouse Profile [csustan.edu]
Re:Striking similarities. (Score:2)
Re:Striking similarities. (Score:2)
Re:Striking similarities. (Score:2)
Re:Striking similarities. (Score:2)
Re:Striking similarities. (Score:2)
Lesser footprint on the planet, less crulety, possibly better for you nutritionaly, less exposure to drugs and hormones,etc.
On the other hand meat is so damn tasty though.....If God wanted us to be vegetarian, why did He make animals out of meat?
Re:Striking similarities. (Score:1)
But yes - it's really not astounding at all that there would be genetic similarities between any mammals. Personally, I find it interesting that multicellular life exists at all
Re:Striking similarities. (Score:2)
Creationism (Score:1, Funny)
Re:Creationism (Score:1)
In fact this would likely lend more credibility to a creation theory than an evolution theory because it would show that a creator simply stuck with a good pattern.
Is it not true when writing code that one typically draws from past experience and often even ressurects code previously used in a successful implementation?
Re:Creationism (Score:2)
Believe what you want,
but when it comes to scientific discussion about evolution, your two cents about creationism don't add anything. Believing that things were designed by God doesnt give you any power of prediction. That is what Science is all about. No one really cares if electrons actually spin, but describing them that way allows you to predict what they will do.
Making claims about creationism when topics of evolution come up just adds noise, and flames. I dont know about anyone else, but I would like it if you would resist the erge to attempt to convert people.
Good for mice! (Score:2)
They could be used for surveilance in this age of fear and vigilance. Might work better than the cat with built in microphone+transmitter that had it's first test cut tragicly short. [bbc.co.uk]
Ali
hmm (Score:2, Funny)
DNA is nice and all (Score:5, Informative)
Another useful link is the project site for the program RNAGENiE [lbl.gov].
Just thought many people would find that interesting.
Re:DNA is nice and all (Score:4, Interesting)
Presumably such families, being important, would be similar between the human and mouse genome and much of the analysis of those similarities involves looking exactly for that.
Re:DNA is nice and all (Score:1)
Ok I gotta say it. (Score:2, Funny)
Genetic Mouse code unveiled (Score:1)
Will it allow me to fix my problems with scrolling and mouse-overs
Does allow us to descibe the evolutionary process of the Ball less mouse, or the mouse wheel.
Re:Genetic Mouse code unveiled (Score:2)
Good luck compiling it though.
By the way, here's a more official press release [embl-heidelberg.de].
What license? (Score:2)
Further: If this is under the GPL (although I doubt it is -- still, it's a good question for the future) and I modify the source organically (through breeding), am I required to release the resulting code? HOW? I don't HAVE the resulting code! (Unless I pay a lot of money to have scientists in six countries sequence it for me...)
Anyway, yeah.
Re:What license? (Score:2)
So, it's pretty much license free. See, that's why us bio-geeks are smiling all the time.
Doesn't Disney have copyright? (Score:4, Funny)
Genetically engineered mice can be patented, so bioengineered or cloned progeny of Mickey may be attractive to Disney Genetics and Licensing, Inc. There is some suspicion [demko.com] Mickey himself is engineered, as he has not aged in over 60 years.
Set Mickey free!
Spoiler Alert: (Score:2, Funny)
acccctcgcagcaccccgcgccccgcgccctcccagc cgggtccagccggagccatggggccggagccgct
agtgagcaccatg
gcgagcacccaagtgtgcaccggcacagacatgaagctgc
acatgctccgccacctc
caatgccagcctgtccttcctgcaggatatccaggaggtgcagg
gtgaggcaggtcccactgcag
tggccgtgctagacaatggagacccgctgaacaataccacccctgtcac aggggcctccccaggaggcctt
gcgggagctgcagcttcgaagcctc
ct
tagacaccaaccgctctcgggcctgccac
gagttc
ctgcccactgactgctgccatgagcagtgtgct
cctgcctcca
cacgtttgagtccatgcccaatcccgagggccggtat
tacaactacctttc
cagaggatggaacacagcggtgtgagaagtgcagcaagccc
ggagcacttgcgagaggt
tttgggagcctggcatttctgccggagagctttgatggggaccca
cagagcagctccaagtgtttga
cagcctgcctgacctcagcgtcttccagaacctgcaagtaatccgggga
tactcgctgaccctgcaagggctggg
gac
gaacccgcaccaagctctgctccacactgc
tgccacc
tccttcggggccaggagtgcgtggaggaatgccg
caggcactgtt
gctgaccagtgtgtggcctgtgcccactataaggaccc
tgaaacctgacctct
catcaactgcacccactcctgtgtggacctggatgacaaggg
ctgacgtccatcgtctctg
tcatcaagcgacggcagcagaagatccggaagtacacgatgcggag
ggagccgctgacacctagcggag
agaatgtgaaaattccagtggccatca
ctta
acatccacggtgcagctggtgacacagctta
gcggacgc
ggatgtgcggctcgtacacagggacttggccgctc
attacagacttc
tgcccatcaagtggatggcgctggagtccattctccgcc
ttatggtgtgactgtg
atccctgacctgctggaaaagggggagcggctgccccagcccc
tcatggtcaaatgttggatg
ccgcatggccagggacccccagcgctttgtggtcatccagaatgagg
gacagcaccttctaccgctcactg
t
ccgcagctcatctaccaggagtggcggt
cccag
cagccaaggggctgcaaagcctccccacacat
agtacccct
aaccagccagatgttcggccccagcccccttcgccc
gtgccactctgga
tgggggtgccgtggagaaccccgagtacttgacaccccag
cctgccttcagcccagc
ccagcaccttcaaagggacacctacggcagagaacccagagtac
cagaaggccaagtccgcagaa
Re:Spoiler Alert: (Score:1)
Of course, I'm officially stereoblind. Like 2% of the population, I'll never be able to see the schooner.
Re:Spoiler Alert: (Score:1)
Re:Spoiler Alert: (Score:1, Insightful)
Now get out of my comics shop.
Re:Spoiler Alert: (Score:4, Informative)
Re:Spoiler Alert: (Score:1)
"Homo sapiens v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)(ERBB2), mRNA"
http://www.ncbi.nlm.nih.gov/blast/ [nih.gov]
map with political, err patent boundaries? (Score:1)
Fool around with kidney's and you will have to
talk to Archer Daniels Midlands. Don't touch that follicle code, It's MIT's and their MEAN!
four colors like a normal map. Have banner ads for
biotech companies that work around patents, near the juiciest bits.
Original Articles (Score:3, Insightful)
Some of the editorials read easily, but are a bit more meaty than little newsbites.
I'm surprised this story didn't make the main page - do people not realize how important this data is? Having a mammalian genome available for comparative analyses with the human genome is a major landmark. The articles I've seen mostly talk about locating genes, but its locating other things - regulatory regions, non-coding RNA genes, and other functional non-protein-coding DNA - that's more difficult, but now possible, and, IMNSHO, much more exciting. Then again, I'm rather biased.
You think that's exciting? (Score:2)
I know what I want for xmas.
This would be really cool if it wasn't so fucking disturbing.
Corrections (Score:1)
Also. The mouse genome is still a draft stage. You can browse it here [ucsc.edu]. The big news is the enormous mouse issue of Nature is about to hit the newsstands. This is a similar situation to the human genome. The Nature paper was published a few years ago, but the actual finished sequence isn't due until April, 2003.
There's a few reasons for this.
In any case, it is still exciting news. In many ways the mouse genome is more valuable than human, because ethics aren't really put into question when genetically engineering mice or throwing them into a blender.
Andy
Actually, side by side mapping is finished (Score:3, Interesting)
Re:Actually, side by side mapping is finished (Score:2)