Forgot your password?
typodupeerror

Human Genome Sequencing Completed 337

Arthur Dent '99 writes "According to this article at Reuters, the last chromosome in the human genome has finally been sequenced, taking 150 British and American scientists 10 years to complete. The sequenced chromosome, Chromosome 1, is the largest chromosome, with nearly twice as many genes as the average chromosome, making up eight percent of the human genetic code. The Human Genome Project has published the sequence online in the journal Nature, according to the article. It contains 3,141 genes (over 1,000 of them newly discovered), and 4,500 new SNPs -- single nucleotide polymorphisms -- which are the variations in human DNA that make people unique."
This discussion has been archived. No new comments can be posted.

Human Genome Sequencing Completed

Comments Filter:
  • First Chromosome (Score:5, Interesting)

    by LiquidCoooled ( 634315 ) on Wednesday May 17, 2006 @09:08PM (#15355353) Homepage Journal
    I won't bore you with the details, but theres lots of GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGC type things here [sacred-texts.com]
    • by PyrotekNX ( 548525 ) on Wednesday May 17, 2006 @09:32PM (#15355466)
      I always wondered where the movie GATTACA got it's title.
    • ... Followed by Quagmire shouting "All Right" whilst thrusting his pelvis
  • So now. (Score:3, Funny)

    by AltGrendel ( 175092 ) <ag-slashdot@@@exit0...us> on Wednesday May 17, 2006 @09:10PM (#15355363) Homepage
    Can we start the patent countdown clock?
  • by FhnuZoag ( 875558 ) on Wednesday May 17, 2006 @09:10PM (#15355365)
    Now where's my +1 Talent in every base?
  • by Anonymous Coward on Wednesday May 17, 2006 @09:10PM (#15355368)
    if God wouldn't have used LISP to encode the darn sequence in the first place
  • by gentimjs ( 930934 ) on Wednesday May 17, 2006 @09:10PM (#15355371) Journal
    I'll take my next kid with larger-than-average height, enhanced frontal lobes, a natural resistance to the polio virus, OH and dont forget the 20/10 vision!
  • A simple question (Score:3, Interesting)

    by helioquake ( 841463 ) on Wednesday May 17, 2006 @09:18PM (#15355397) Journal
    Why do one chromosone have more genes than others?
    • They are all different sizes. Chromosomes are numbered from largest to smallest 1 - 22 (except 21 and 22; 21 is actually the shortest and 22 is slightly bigger; the mistake was made in early cytogenetics because they couldn't distinguish the sizes well enough and those two were named incorrectly) + X and or Y. So chr 1, being very large, has a very large number of genes just because it's huge. It isn't the most gene dense, however, which is chromosome 19 with more genes / Mb than elsewhere in the genome.
    • by SnowZero ( 92219 ) on Wednesday May 17, 2006 @09:25PM (#15355434)
      Evolution is a process with a lot of randomness. So I'd instead ask the question: Why would you exepct them to be the same?
      • Don't confuse randomness with not knowing how it works. Perhaps it just LOOKS random because we don't see or understand the pattern/function yet?

        It seems to me that there are definitely some "rules" for evolution, although our understanding of them and how they work is very very limited -- for now. I mean, we don't see trees evolving into dogs and vice versa. So clearly there are some constraints on what can and can not be done within evolution.

        But it's a hard thing to study because we've only bee
        • Evolution is inherently random, unless you're defining random as non-deterministic. Which nucleotide is botched in the replication process, or thumped by a cosmic ray is pretty random.
    • Re:A simple question (Score:5, Informative)

      by FTL ( 112112 ) <`eman.resarf.lien' `ta' `todhsals'> on Wednesday May 17, 2006 @09:30PM (#15355461) Homepage
      > Why do one chromosone have more genes than others?

      Same reason some source code files contain more lines of code than others. They do different things.
      • That suggests some organization. It's more like why one patch in the sky contains more stars than another. Of course, there are some patterns, like the original Milky Way streak towards the center of the galaxy, but most of it is just a coincidence without any real "reason".

        Another way to put it is that there has obviously not been enough of a disadvantage to have varying chromosome sizes, alternatively some slight advantage in maintaining something similar to the current layout. (Of course, significant ch

        • I also consider that one of the chromosomes could maintain (as a unit) the code for some very complex interaction that can't be further broken down. Maybe something to control the expression of genes, p2p communication (to correlate production of proteins, etc.), or even the definition of types for cell differentiation. Or a kind of file full of unique keys to keep the immune system from attacking the body's own cells (errors in which might result in allergies). Consider the size of concurrency control a

    • Because it evolved (Score:5, Interesting)

      by GrahamCox ( 741991 ) on Wednesday May 17, 2006 @09:34PM (#15355478) Homepage
      Why do one chromosone have more genes than others

      Why not? It's because it wasn't designed by a computer geek (or anyone/thing else) where you might have said, hrmmm, we need about 30,000 genes for this design, so we'll split that into 26 chromosomes of 1,154 genes apiece. That should do it!

      The fact is, we evolved, and so our components are just bits and pieces taken from all our previous ancestors, modified according to whatever was needed to suit the environment we happened to find ourselves in at the time. As with all natural, biological, dynamic processes, what emerges is often bizarrely disorganised, yet somehow works.
      • Of course I meant 46 chromosomes...

        Actually if it was designed by a computer geek, no doubt there would be 32,768 total genes and 32 chromosomes, with 1,024 genes per chromosome.
        • by account_deleted ( 4530225 ) on Wednesday May 17, 2006 @10:09PM (#15355638)
          Comment removed based on user account deletion
        • by fyngyrz ( 762201 ) on Thursday May 18, 2006 @05:52AM (#15356118) Homepage Journal
          Nonsense. We'd design it to have 32 bits to index the chromesomes, 32 bits to index the genes in each chromesome, and an alternate set of registers so you could quickly swap chromesomes for different tasks. You could clock it at any speed, or leave it static, and it'd never lose data. It'd be radiation hardened, low-power, erasable by ultraviolet, reprogramable by anything from dip switches to GHz pulse trains, internally and externally redundant, solar-powered, ecologically friendly, and involve a great deal of caffiene. Primary developmental needs would be met by carefully metered infusions of pizza.

          However, because of technological limitations, only the bottom 4 bits of the gene index would actually be used, with the next 4 bits being set to zero by default, and the remaining 24 bits determining your average skin color.

          Additionally, the 32 bit chromesome index would use 8 bits starting at the MSB, the next 8 bits would be reserved and set to zero, and the remaining 16 bits would be undefined, though later we'd find variations there gave rise to both creationist tendencies and division by zero, leading us towards a new design that is only 16 bits, but ran twice as fast and never divided by zero, or made up answers to questions without having known good data on the input side.

          All other features would be put off for the beta version, because we'd have a little trouble with the alpha we didn't exactly anticipate.

          Unfortunately, all advances gained by this leap in technology would be lost when hardware manufacturers forced new "quantum confusion" technology upon the geeks in a selfish race for more market share. Geeks fail to notice because they're too busy trying to get Genes 0.1 alpha through ANSI committee approval.

          For maximum efficiency, this awesomely fast new technology requires light pipes for communications, however, in a legislative feat worthy of Maltheus himself, congress declares that production of light pipes within the boundaries of any state for use within the boundaries of that state represent interstate commerce of light paraphanalia, and so no one's going to be doing that, thank you. It's all part of the War on Bits. InSmell, primary manufacturer of light pipes in the USA, shuts all production down, fires half its workforce, and its stock goes up by a factor of four.

          At this point, the only light-pipe architecture you can find comes from Japan, and the upper 24 bits of the gene index are all hard-coded to DDDDBB. It is expensive, but everyone buys it anyway. You can only run this hardware in Denmark. Floating (actually, more like drifting) point is emphasized, and virtual reality is experienced by all users, though that is not to say that it is the same virtual reality across the board.

          In the meantime, US geeks invent open-source web 9.0, expend all their energy producing applications for it that have absolutely no merit whatsoever of any kind using the justly famous "Corundum on Wagon Ruts" technology to replace perfectly good desktop apps that already exist, but are really really cool because they can make almost any browser's "Joe" scripting language use all the memory in your computer... subsequently, geeks quietly go extinct while arguing if GPL or PD is the way to go for the open source path.

    • It may seem logical to respond that evolution yields varied results, or throw up hypotheses about the physics involved or whatever the hell you want. But these do not explain cause, and cannot answer why chromosomal size is varied.

      So, if you really want to know, the answer is...

      because.
    • Re:A simple question (Score:3, Informative)

      by natrius ( 642724 )
      In addition to what the other posters said, the chromosomes are numbered by their size up chromosome 22, then the 23rd pair is the X and/or Y chromosomes. Since this is chromosome 1 we're talking about, it's the largest one.
  • by GoofyBoy ( 44399 ) on Wednesday May 17, 2006 @09:24PM (#15355424) Journal
    "To map the very stuff of life; to look into the genetic mirror and watch a million generations march past. That, friends, is both our curse and our proudest achievement. For it is in reaching to our beginnings that we begin to learn who we truly are."
          -- Academician Prokhor Zakharov,
          "Address to the Faculty"
    • Why do you insist that the human genetic code is "sacred" or "taboo"? It is a chemical process and nothing more. For that matter -we- are chemical processes and nothing more. If you deny yourself a useful tool simply because it reminds you uncomfortably of your mortality, you have uselessly and pointlessly crippled yourself. - Chairman Sheng-ji Yang, "Looking God in the Eye"

      Complete list of quotes here [generationterrorists.com], although for full effect you really need to hear some of them. The voice acting on Alpha Centauri is amon
  • Oblig. (Score:5, Funny)

    by mk_is_here ( 912747 ) on Wednesday May 17, 2006 @09:26PM (#15355437)
    Scientists: All your base pair are belong to us!
  • Remember kids... (Score:4, Insightful)

    by TheOldSchooler ( 850678 ) on Wednesday May 17, 2006 @09:26PM (#15355439)
    Your single nucleotide polymorphisms are unique! Just like everyone else's.
  • by GroeFaZ ( 850443 ) on Wednesday May 17, 2006 @09:27PM (#15355442)
    ACGATCGTACGcopyrightTAGATCGCGTAGTAGCTAGCTGTbyGGCGG CGGTACGGCTATiehovaAGTCGATCGATGATCG5billionBC-TAGCT AGCTAGCTAGCTAGinfinityTAGTAGTATTTATTTunauthorizedA GGCGGTATGCTAGCTAGreproductionCTGATGTGTAGCCCAprohib itedCCAGCTTAGCTAbyGCTAGCTAGTGTAAATCGCCATCGCGCCTAdi vineTTCTCTAGAGCTTAGCATGCTAlawCGTACGTAGCTA
    • Dear sir(s)

      You have posted parts of our patented human genome sequence without our prior authorization. We demand that you cease and decist this post and remove it immediatelty, or you will be hearing from our lawyers in short order.

      Sincerely,

      Genectics Mega Corp.
    • by ggvaidya ( 747058 ) on Wednesday May 17, 2006 @10:51PM (#15355824) Homepage Journal
      ACTTTTTCGCGAGAGGAGAGTGAGT//todo:this should only return a positive values!AAAAAATTTCTATCTACTATCTACATATCATTACA/*warnin g we are kluding around the antique "arthropod" module, here there be bugs!*/AAAACTCTTATCTATTTATTCATCTATCATTCATCTATCATCT ACTACTATCTAATCTATACA//haha nice hackACTCTACTATAGATCGATGT
  • SNPs (Score:5, Informative)

    by Michael Woodhams ( 112247 ) on Wednesday May 17, 2006 @09:31PM (#15355463) Journal
    From the fine article:
    "The scientists also identified 4,500 new SNPs -- single nucleotide polymorphisms -- which are the variations in human DNA that make people unique."

    There are other variations which make us unique.
    Alternate alleles*
    Indels (insertions/deletions)
    Variable numbers of repeats.*

    The genetic code uses 4 letters, but I'll use English for explaination.
    A SNP is a single letter which has different values in different individuals: "The cat and the dog" vs "the hat and the dog".
    An indel is where letters have been inserted into one sequence or deleted from another (without additional data, we can't distinguish these possibilities.)
    "The cat and the dog" vs "the cat and the big dog".
    In alternate alleles there are a bunch of changes which always stick together, e.g. we observe "the cat and the big dog" and "the cat and the small mouse", but never (or exceedingly rarely) "the cat and the big mouse" or "the cat and the small dog."
    Variable repeats are a special case of indels, but common enough to warrant a category of their own. "The cat and and and the dog" vs "the cat and and and and and the dog".

    • by LS ( 57954 )
      Thanks for the "plain" English, now again WTF are you talking about? I have no idea. Your comparisons in quotes make no sense. cat vs hat? big vs small? cat vs dog? What are these supposed to represent again?
    • I don't see why you would mention alternate alleles as something different. They're just SNPs kept closely together, or even indels within the coding sequence. (And some other traits have been shown to actually be varying repeat lengths, as well.) From a phenotypic perspective different alleles are naturally different than "hidden" markers, and of course we have a significant selection pressure on that material, but they're still not a different kind of variation.
    • Interesting post. I noticed that the "Variable numbers of repeats" looks a lot like microsatellite instability (MSI), where extra copies of short sequences get inserted. Like ATATAT becomes ATATATAT. I'm not entirely up-to-date on what happens as a result, but certainly the encoded protein may lose or alter its function. This type of genetic instability is characteristic of certain types of cancer, like certain colorectal cancers, particularly when a mutation knocks out a crucial repair pathway gene.

      Do

  • Finally! (Score:2, Insightful)

    by Tehrasha ( 624164 )
    So we can start compiling from source code now! We better get this covered under the GPL quickly.
  • 3,141 genes (Score:2, Funny)

    by Iznogood ( 26287 )
    pi * 1000 genes. Got to love those fun coincidences.
    • Re:3,141 genes (Score:5, Informative)

      by pchan- ( 118053 ) on Wednesday May 17, 2006 @10:01PM (#15355601) Journal
      You seem to be under the impression that the number 1000 has some special meaning. Let's try your comment again, in octal:

      pi * 1750 genes. Got to love those fun coincidences

      Not so exciting now, is it? Nature is not decimal-based. The only reason we tend to be is because of the number of fingers we have.
      • Re:3,141 genes (Score:3, Insightful)

        by vrt3 ( 62368 )
        Indeed, and the number of fingers we have is specified in the genes, so maybe it's not a coincidence after all?
      • Re:3,141 genes (Score:5, Interesting)

        by Opportunist ( 166417 ) on Thursday May 18, 2006 @07:07AM (#15356300)
        Actually there are a few "numbers" that are "magic" in nature. Depending on the species.

        10 certainly is important to us, having 10 fingers and 10 toes. Unless you're carpenter.
        Asking a bee, you'd prolly be called crazy and 6 is the perfect number, from legs to comb.
        A spider would probably tell you 8 is more important, from legs to their web's segments.

        But since this genome has meaning for us, I'd wager that our "magic" applies.
    • mmmmMMMMM...... 1000 pies and my jeans won't fit anymore. Co-incidence?
    • by gwayne ( 306174 )
      That's no coincidence, it's the circle of life...
  • Wake me when they make Cobra Commander.

    Joey stole mine when I was 12. He rocked.
  • protein modelling (Score:3, Insightful)

    by sc0p3 ( 972992 ) <jaredbroad.gmail@com> on Wednesday May 17, 2006 @09:43PM (#15355517) Homepage Journal
    This is good news but not too useful until we can model protein shaping.

    The AGCT's code for proteins and so far we can only model very short combinations. All you coders keen for a life project have a crack at it. Theres 20 amino acids formed from combinations of three base pairs. The amino acids have attraction and repulsion properties with each other and their environment and form to make a unique shape. Its the analysis of that 3D shape that will solve:

    - all cancer - modelling protein shapes means instant cancer cures
    - bird flu - again modelling proteins means instant antibodies to diseases
    - the most toxic substance ever invented - it will also open up designer drugs
    • It's already underway. Take a look see at http://www.grid.org/projects/ [grid.org]

      Better yet download the client and throw some spare CPU cycles into the mix.

    • All you coders keen for a life project have a crack at it.

      You do know it's not primarily a programming issue?


      Its the analysis of that 3D shape that will solve:
      - all cancer - modelling protein shapes means instant cancer cures


      Nonsense. Knowing the shape of a protein does not cure cancer in itself. You do know that the structures of thousands of proteins, hundreds of which are cancer related, are already known?

      bird flu - again modelling proteins means instant antibodies to diseases

      No, knowing the structure o
    • Sorry to say that, but you are overly optimistic here, as k98Sven stated above. I work in structural biochemistry, so let me clear up a few points here:

      First of all, you can't at the moment crack the protein folding problem by throwing more computational power at it. We still lack lots on insight into many of the fundamental forces governing protein folding. Electrostatics at that level are a nasty thing, for example. The scale of the system would require a quantum mechanical treatment, but then again the

  • by Anonymous Coward on Wednesday May 17, 2006 @09:44PM (#15355524)
    gtcatgcgatacgtaggcaaatcg2tgacggcagt

    hmmm i guess its not as funny unless its binary
  • by jerometremblay ( 513886 ) on Wednesday May 17, 2006 @10:01PM (#15355605) Homepage
    How do they differentiate junk dna from genes?

    I undestand that even if they don't know what a gene is doing, they can single it out from the rest of the dna. How do they do that?

    What makes a gene a gene?
    • What makes a gene a gene

      Well all genes start with the sequence "ATG" and end with a stop sequence eg. "TGA" (there are several). See http://en.wikipedia.org/wiki/Codon [wikipedia.org]

      There are a lot of exceptions to all of this, eg. stop codons, RNAs, psuedo genes ect.. But it is generally true from a computational point of view.
    • The answer, for bacteria and yeast genes are used to make protein. They start with a 3-base sequence that signals "start making protein," have some sequences that tell the cell which amino acids to put together to make the protein, and end with a 3-base sequence that signals "stop making protien." 3-base "stop" sequences occurs pretty frequently in the genome (just by random chance), so, if you find a long sequence that doesn't have a "stop" sequence, you can be pretty sure it's a gene. For more complicat
    • In addition to what's already been mentioned, there are some highly characteristic start sequences "upstream" from the actual coding sequence, including what's called a "TATA box", a sequence of about eight nucleotides, where the most preserved part is TATA. The individual nucleotides vary a little, but it's still quite detectable in the overall noise.

      In addition, we have other effects. For example, there is a varying stability between GC and AT pairs, which gives a tendency to a biased ratio in "junk". Th

  • A dozen actual people please. It doesn't count if your just mixing chromosones from different people to claim you have a complete DNA decoded; there is no gaurantee that mix of dna would be viable. There ought to be a panel of scientists to select 12 people to have their DNA read that are willing to be studied for the rest of their lives. Six men and six women. At least some of which would be siblings. Only then can you actually decode DNA. You'll get 90% of the answers there.

    You always go with a base
    • True, rearrangements do happen and, true, there is some chance that you have two lucky mutations in the same chromosome that each by itself is lethal. On the other hand, almost all haploid subsets of your genome are carrying lethal traits. So, what you request is sequencing of both copies. We want to get there, sometime, but if we should look for errors, I think the issues of being sure that the full contig sequence is the "true" one are more important, especially in repeat-rich sections.

      The current data i

  • The L'Enfants Terrible Project can get underway.

    Just... 30 years too late.
  • This is obviously great and all, but didn't they announce the Human Genome Project was complete 3 years ago?
    • Indeed. And it will be complete once again in a few years.

      Once you get beyond a certain point of "complete", there is no real boundary from where you can claim to be more complete than before.
    • Re:Great But... (Score:3, Informative)

      by lbbros ( 900904 )
      Completing the sequence and actually putting it together are two entirely different affairs. Small sequences called ESTs (Expressed Sequence Tags) were obtained during this effort. The big task after that was to put everything together AND in order. Think of it as a massive puzzle. Even the genome has different "builds" depending on the level of completeness of this work.
  • Slow (Score:2, Funny)

    by Joebert ( 946227 )
    At that rate, it must be a group made entirely of male scientists.

    All I have to do is open my mouth once & any female can sequence my genes instantly.
    Their accuracy is amazing, I always get the same conclusion, "You're an asshole !".
  • 3,141 genes? (Score:3, Interesting)

    by SashaM ( 520334 ) <msasha AT gmail DOT com> on Thursday May 18, 2006 @05:54AM (#15356128) Homepage
    Did anyone else find the number 3,141 [google.com] interesting? Is that a coincidence, or is there a good reason?
    • Yea, especially since you have exactly 3,141.59... genes.

      And the distance from the base of the Great Pyramid is exactly twice the distance times 3/23 - the number of pounds in a dozen African Eliphants minus the sum of them... ... you get 666! Therefore, your genes are the antichrist. We should change public policy to better fit with this.
  • Finished my ass (Score:4, Interesting)

    by pugdk ( 697845 ) on Thursday May 18, 2006 @07:33AM (#15356384) Homepage
    There are still large gaps in each chromosome, either due to repetitive sequences, high GC content or closeness to the centromere - basically saying that the human genome is finally done is like saying that 99.9% equals 100%, which it doesn't. This is especially important in cases where you actually NEED to use sequence in areas where it has not been assembled correctly or has not been sequenced... which has happend to me multiple times during the last couple of years... oh and those places in the genome have been unfinished ever since the first installment appeared publicly... they are even lacking in the Celera version of the genome... Finished my ass! -pug
  • by ill dillettante ( 658149 ) on Thursday May 18, 2006 @07:51AM (#15356444) Homepage
    It is actually only about 75% complete - basically the scientist involved have no idea how to finish the remaining sections (mostly simple repeats) so they have "defined" the genome complete by saying that these regions are unimportant.

    This is by my count the fourth time that the human genome has been announced "finished" - anymore times and they will all be invited to become slashdot editors.

No problem is so large it can't be fit in somewhere.

Working...