New Science Museum - Now With Real Science! 242
OpenYourEyes writes "There is a new
science museum, run by the National
Academy of Science, that has opened in DC. So what? Unklike many
museums which simplify their message or use fake data, the exhibits at
the Koshland Science
Museum are all based on real research, real reports, and real
science. Each one contains references to the research reports and
data they are based on. Exhibits on
DNA, for example, use actual (and long!) DNA sequences to help
illustrate how DNA plays a role in disease, agriculture, and
criminology. There are also exhibits on
Global Climate Change and
The Wonders of Science."
And... (Score:5, Interesting)
Re:And... (Score:2, Interesting)
Scariest Thing (Score:5, Funny)
Re:Scariest Thing (Score:5, Funny)
Finally! (Score:5, Insightful)
My take.. (Score:5, Insightful)
I doubt they do this because they want to, think about it.. joe average would much rather see flashy presentations than boring old research papers. It's sad but true.. and museums have to do this in order to bring people in..
Re:My take.. (Score:2, Insightful)
Re:My take.. (Score:5, Funny)
What I'd like to see... (Score:3, Interesting)
Okay, so maybe it's not "a lot" of time, but it's a significant amount. What I'd like to see is "television for people with three digit IQs." The current fare is distinctly lacking in that area.
Re:What I'd like to see... (Score:5, Interesting)
THC still occasionally has some interesting things, and they have a knack for finding mundane things and making them interesting (like being able to be fascinated by an hour on the history of hand tools). Their library is starting to run thin, though, with more and more WW2 material showing up again (someone once referred to it as The Hitler Channel for its preoccupation with WW2 documentaries), and now they're turning too heavily towards commercial entertainment. I don't mind the occasional such movie (such as when they show "Tora! Tora! Tora!" while discussing the attack on Pearl Harbor), but it's turning into an open entertainment platform instead of the educational platform it could (and, IMHO, should) present.
Re:What I'd like to see... (Score:2)
(Yes, I read it and enjoyed it.)
Re:What I'd like to see... (Score:2)
Re:What I'd like to see... (Score:2, Insightful)
1. WEEEE!! BIG EXPLOSIONS/DEATH ROBOTS/FAST CARS!!!!11111
2. the bible code/nostradamus/crop circles are stupid, but lets take them completely seriously anyway.
3. this isn't about the movie that's Opening Friday! it about a topic that is tangentially related to the movie that's Opening This Friday!
4. lets replace your interesting house/clothes/hairstyle with one that conforms to our inane social standards!(they replaced a room filled with giant lego stu
Re:My take.. (Score:5, Insightful)
I quick flip through the website shows that they still have a flashy presentation, but then you have the option of looking at further reading (both scientific journals and popular media) and other websites. This is a definite improvement and I think it may be the museum equivalent of making the source code available. ("Hey, we're not just BSing, take a look at the research that backs us up!")
Re:My take.. (Score:2)
Joe Average is going to be at the game, not hanging out in a science museum...
Re:My take.. (Score:4, Informative)
"This is not an artifact-based museum," Peter Schultz, the museum's exhibits and public programs director, told The Scientist. "It's focused on how science can better inform decision making." [biomedcentral.com]
It's not really aimed at the average joe, it's aimed at the guy that gets presentations on whether or not to fund some kind of genetic disease research project, or whatever. All the exibits are geared towards the sort of things beaurocrats have to deal with these days, but don't really understand. The exhibits rotate, but they all have a goal in mind. The first three are, respectively, to keep congress from going all knee-jerk on genetic engineering/promote the FBI DNA database, to get politicians to quit pretending global warming is imaginary, and to show off cool shit like dark matter so the NSF can get better funding next year.
Re:My take.. (Score:2)
At some point someone has to say, well maybe we're doing more harm than good by going after the Average Joe
Covered on NPR (Score:5, Informative)
Here's the obligatory link [npr.org]
Re:Covered on NPR (Score:2, Informative)
For those that don't remember, he used to host Newton's Apple [ktca.org] when it first aired. He also does numerous reports for NPR, as well as the weekly Science Friday [sciencefriday.com] (which any self-respecting
Besides, I think Lisa would pimp-slap him on general principle.
Dumbing down is a good thing (Score:2, Interesting)
Re:Dumbing down is a good thing (Score:4, Insightful)
If knowledge is presented in the right way, with plain English and interactive exhibits, why can't we also have the background, and references to actual research as well?
Re:Dumbing down is a good thing (Score:2)
Yeah
WORDS TO HARD
Climate Change (Score:3, Interesting)
Good work!
Re:Climate Change (Score:2)
Sample quote:
Re:Climate Change (Score:2)
Re:Climate Change (Score:2)
CO2 contributes more to the recent increase in greenhouse warming than any other gas. CO2 persists in the atmosphere longer and longer as concentrations continue to rise.
Other chemicals such as methane, nitrous oxide, and halocarbons also contribute to the global greenhouse effect. A number of additional chemicals related to urban pollution, such as low-level (tropospheric) ozone and black soot, can have a strong regional and perhaps global warming effect. Sulfate aerosols may have
Re:Climate Change (Score:3, Insightful)
The inevitability of some change is not a subjuct of debate... except among some en
Coo (Score:2, Interesting)
What's wrong with simplifying the message? (Score:5, Insightful)
Huh? (Score:4, Insightful)
(I can understand simplifying it, but outright faking it?)
Re:Huh? (Score:2)
Re:Huh? (Score:2)
Of course, most of the displays (like the ones at the Smithsonian's Natural History Museum) are not the actual fossils. Way too much opportunity for damage in public displays.
Re:Huh? (Score:2)
Re:Huh? (Score:4, Interesting)
(I can understand simplifying it, but outright faking it?)
How about explanations of potential energy? Have a ramp 3 meters high with a bowling ball on it. Let the bowling ball go. How fast will it be going once it reaches the bottom of the ramp? Well, calculate the potential energy of the ball at 3 meters. Convert that directly to kinetic energy to achieve a speed at the bottom. Put up a nice little chart for everybody to see. This would be fake data. Unless, of course, you account for friction between the ball and the ramp which uses some of that potential energy to overcome. The energy lost in getting the ball to rotate. Also consider air resistance, experimental error, etc.
Real science is putting up an exhibit where people can start the ball rolling and have the speed automatically calculated at the bottom. Let them do this three times and write down the end speed for each time. Then show why the speed isn't what typical calculations would give because of the reasons mentioned above. For hardcore science, teach them how to calculate the energy lost due to angular momentum, coefficient of friction between the ball and the surface, etc.
And as an added bonus (Score:2)
Museums are supposed to be fun, not hard work.
Re:Huh? (Score:2)
I think what they mean is that some of the charts and graphs displayed in an exhibit may not an original copy. The examples may have been sanitized to look better than they do in real research. For example gas chromatographs are a mess of peaks but graphs next to a display may show clear and definite peaks.
Washington DC (Score:3, Interesting)
Re:Washington DC (Score:3, Insightful)
Getting to Washington, D.C., is not exactly challenging, and while it can be expensive, it's one of the few cities in America where you can see the sights for next to nothing, if you plan properly.
As for not having the desire to go there, well, we can't exactly bring the world to everyone's doorstep. Besides, it's easier to visit one place and see many great things than it is to visit man
Re:Washington DC (Score:2)
tap... tap...
Just once second...
low whispering...
Hmmm, it appears that maybe this has happened in the past, who knew!
A bit OT... The Boerhaave Museum (Amsterdam) (Score:3, Informative)
Also a lot of fun was the History of Science Museum in Florence [firenze.it].
Science is not facts on parade . . . (Score:5, Insightful)
So many museums have pretty diagrams showing "facts" but not much of the thinking that shows how we discovered and got to those facts (or conclusions or theories as the case may be).
Science is not facts. It's not bullets. It's not a list of terms describing a cross section of the earth. It's problem solving, experimentation, cross examination, peer review, drawing conclusions, making inferences, designing experiements . . . it encompasses higher thought processes than memorization of facts. Why don't most of the museums make an effort to show this?
Science is not facts. (Score:3, Interesting)
*** SPOILER ***
But he was clever - while all knowledge was wiped, he managed to hang onto *the scientific method*, so he and his race could accelerate progress in the future.
Re:Science is not facts on parade . . . (Score:2)
How Science Works [amazon.com]
That may be its title, but the book is all about temperature/pressure and rockets. That's like showing a sweater and saying "This is how knitting works."
No wonder people are so scientifically illiterate.
Yeah! (Score:2)
#9000000! (Score:2, Funny)
Interesting. (Score:2)
Sadly we'll never know who's the winner...
Re:#9000000! (Score:2)
Dude, where's the Freaky moderation?
Wow! Actual DNA sequences! (Score:2)
There are 3 billion base pairs in the human genome.. any sequence short enough to be bearable for someone to look at without getting bored is going to be in there somewere.
Oh look at that.. in a normal person it's ATGTAAGTATAGCCTAGACTA and in the mutant it's
ATGTAAGCATAGCCTAGACTA.. how interesting!
Not really.. And I'm not saying biochem isn't fun, but looking at sequences, real or otherwise is about as boring as watching paint dry.
Re:Wow! Actual DNA sequences! (Score:2)
I wonder how many people would actually go to this (Score:3, Insightful)
Re:I wonder how many people would actually go to t (Score:3, Interesting)
To me, this is clearly an example of real science that people can talk about at home.
Never understood obsession with "understanding" (Score:5, Insightful)
On the other hand, why must the whole exhibit be geared at the introductory level? A museum is a big place. Surely at least a little bit of room could be spared for some more sophisticated information in parallel with the simplified stuff? 10-year-old and Dad ought to be able to learn something.
(I have a similar criticism of the educational system. Why should we expect every child to 100% master the same math? Instead, set a baseline, and include varying levels of math in the same lessons. Especially as you get into Algebra and beyond, it's increasingly easy to challenge your students while making sure everyone understands the baseline, even in the exact same classroom. The myth that every student should perform 100% on every assignment is one of the worst blocks to educational reform today. We should expect children to get things wrong... because next time they try, they'll do better, and next time, they'll do better, and next time, they'll do better, etc.... and those children end up way ahead of the ones confined to just what they can do ~100% the first time... and as we've seen, 100% perfection has a habit of receding over time, instead of advancing as we need.
It's all the same fallacy, playing out over and over again, museums, schools, college, television shows, everywhere.)
Re:Never understood obsession with "understanding" (Score:2)
Re:Never understood obsession with "understanding" (Score:2, Insightful)
Re:Never understood obsession with "understanding" (Score:2)
No, that's the theory, a theory which is now being paid less and less lip service, let alone actually being implemented. Even so, if the system doesn't have built-in retries with the expect
Hopefully few corporate spondsered exhibits (Score:4, Interesting)
Dumbed down? (Score:2)
The passive pages in the climate section were excellent. They found exactly the right words to express complex situations in clear, simple language, without skewing the importance in either direction. If you actually understand the situation you will understand how very carefully the words were chosen. Excellent job.
Oops... (Score:4, Funny)
Good Science Museum needed in DC (Score:3, Interesting)
1) a intricate diorama of two (white, male) 19th century scientists arguing about who got the credit for inventing saccharine,
2) control panel for a nuclear reactor, and some of the flash-ash images from Hiroshima,
3) blamed the invention of birth control pills for the decline of the American family,
4) the ONLY use for nylon they could come up with was
Lots more in that vein. Not a single positive image of science or scientists in the whole thing. American Chemical Society paid 2 million to put that exhibit up, and were so furious with what had been done with their money they insisted their name be removed from it. Plenty of false information in *that* museum exhibit!
Re:Good Science Museum needed in DC (Score:3, Insightful)
1) a intricate diorama of two (white, male) 19th century scientists arguing about who got the credit for inventing saccharine,
Weren't most of the American (meaning from the US) scientist in the 19th century white males? Although it certainly doesn't reflect today's demographics, this sounds like an accurate representation of history.
2) control panel for a nuclear reactor, and some of the flash-ash images from Hiroshima,
Well, this s
Re:Good Science Museum needed in DC (Score:2, Insightful)
back to the roots! (Score:3, Funny)
Now a science museum with real science.
What's next? TV news with real news?
Sounds like America is experiencing a "back to the roots" movement!
Egad, fake science! (Score:2)
SanFran Exploratorium != Science. (Score:2)
I'm not sure what medical textbook [bible.com] they are using, but I hope that my doctor doesn't use it.
I boycott the museum whenever I can since
The face of real science (Score:2)
How does it compare? (Score:2)
My geek friend, was not a scientist, by the way. But she did tell me about a rather fascinating fact. It'd been a childhood dream of mine to attend spacecamp (having been in
Flame War! The Best Science Museum Is.... (Score:2)
I grew up in Toronto and the Ontario Science Center [ontariosciencecentre.ca] was a favourite haunt.
Sadly I now live in Vancouver with only the pathetic Science World [scienceworld.bc.ca] and the ungodfully overpriced Space Museuem [hrmacmilla...centre.com].
Re:More global warming pseudo-science (Score:2)
Minnesota's a lot warmer now (Score:5, Funny)
I know. The snow used to be a lot deeper. When I was a 5 year old, snowbanks sometimes came up to the top of my head. Years later, it is hard to find snowbanks much more than knee-deep.
Re:How long until they lose funding? (Score:3, Informative)
When it's a cold winter, I hear people chortling over how ridiculous global warming is. And when it's a warm winter, I hear people fretting over how global warming must be taking place.
My point here isn't to argue that global warming isn't happening (that invol
Re:My take on the subject (Score:2, Funny)
Re:My take on the subject (Score:2, Informative)
"Best enjoyed by visitors ages 13 and older, the museum will explore current scientific issues at the core of many of the nation's public policy decisions, as presented in reports by the National Academies."
Admissions:
Adults: $5
Seniors (65+), Active Duty Military (w/ ID), Students (w/ ID), Children(ages 5 - 18): $3
So the target age range is a little higher... Interesting to note that children 5-13 have to pay $3 to see exhibits that are not meant for them.
Re:My take on the subject (Score:4, Funny)
No that would mean he's a theatrical agent.
A Cabaret is a stage performance or more specificaly a theatrical revue. A BERET is a hat or something you wear on your head. Unless of course you can manage to balance an entire theatrical production on your head in which case you're a circus performer of the highest order of talent.
you take wrong. (Score:5, Insightful)
Re:you take wrong. (Score:2, Insightful)
I good piece of art is one where you can look back on it and say "this depicts how people were back then" or something. It speaks for them.
Fuck if my theoretical [if I paid taxes] tax dollars went to the art it should at least represent me!
Tom
Re:you take wrong. (Score:2, Informative)
I think you may be confusing art with a history textbook.
Fuck if my theoretical [if I paid taxes] tax dollars went to the art it should at least represent me!
Representation is not what art is about. Plenty of lousy movies represent us, but I would say they are not art. A video camera can capture you and television represent you. This is also not art.
Art is abo
You misunderstand 'art.' (Score:2)
Re:You misunderstand 'art.' (Score:2)
The fact that out of hundreds of millions of representations there is only one Mona Lisa or Nefratete proves my point rather nicely.
Re:you take wrong. (Score:3, Insightful)
By that definition everything outside the realists is probably not good art
Perhaps a little art history would broaden your definition of good art a bit. For example, the impressionists did what they did because they were pushed out of realism by the science and art of photography. It was no longer relevant to try to capture reality because reality was better capture
Re:you take wrong. (Score:3, Insightful)
It's nice to know that you're so capable of defining what a "good peice of art" is when so many of the masters were unable to define it themselves. I'll agree that the art may speak to the viewer, but I'll stop shy of stating that the artist has absolute control over what I (or anyone else) might get from the art.
All art is like pornography, I may not be able to tell
Re:My take on the subject (Score:5, Insightful)
The Mona Lisa is just a plank of wood with paint slathered on it. Rembrant's sculptures are just chunks of rock; hell I can get those for free.
Just because you don't like it doesn't mean it's not art. If a musuem paid a million dollars for something shiny, and it's the only one of its kind, then that's exactly what it's worth.
Re:My take on the subject (Score:2)
Re:My take on the subject (Score:3, Insightful)
Hear, hear! If I see one more Monet, Manet, Renoir, Van Gogh, Cezanne, Van Dyke, Picasso, Degas, Botticelli, Rodin, Raphael, or Bosch--I swear, I'm gonna flip out. You pracically trip over these things at your typical so-called art museums, and they've been around for ages!
Note to curators: go visit the Centre Pompidou, MoMA and Tate to see what real art looks like. Quit wasti
Re:My take on the subject (Score:2)
That said, it's pretty common to see at least one example from one of these artists in your typical 'classical' art museum, even if it isn't one of the big name museums. Even the Baltimore Museum of Art (it's good, but I don't consider it a heavy-hitter in the world of art museums) has permanent exhibits containing works by Rodin, Mattise, Picasso, Cezanne, Gaug
Re:My take on the subject (Score:2)
There are only so many 'great' works, and they're disproportionately held by a handful of museums worldwide. It's practically impossible to run a museum without padding of some sort, whether in the form of galleries filled with middling portraits of long-forgotten merchants or as row after row of ancient cutlery and clothing.
After all, wha
Re:My take on the subject (Score:2)
Re:So, that Global Climate Change exhibit... (Score:2, Funny)
No, it'll just be hidden behind the creationism exhibit, by executive order...
Re:So, that Global Climate Change exhibit... (Score:5, Funny)
Re:So, that Global Climate Change exhibit... (Score:2, Interesting)
I mean, I assume you don't dispute that the global average temperature [grida.no] has been increasing over the past few decades. So would you say that climatologists haven't proven that this is outside the bounds of normal climate variation? If so, what sort of evidence would satisfy you in this regard? Can you offer any data to show that this trend isn't significant?
Re:So, that Global Climate Change exhibit... (Score:3, Insightful)
Re:So, that Global Climate Change exhibit... (Score:3, Informative)
a: carbon dioxide is increasing in the atmosphere (see the Climate Monitoring and Diagnostics Laboratory [noaa.gov])
b: carbon dioxide absorbs infrared radiation (graph [nasa.gov])
So an increase in CO2 should lead to an increase in temperature, which we observe. Any questions?
Re:So, that Global Climate Change exhibit... (Score:3, Informative)
Re:So, that Global Climate Change exhibit... (Score:3, Informative)
yes. we can even quantify how much energy the CO2 traps (radiative forcing): 1.46 W/m^2. (Current Greenhouse Gas Concentrations) [ornl.gov] A little more than the 1 W/m^2 difference between the max and min of the 11-year solar cycle. Total change in solar radiative solar forcing since the Maunder Minimum (associated with the "little ice age") is estimated at [grida.no] 0.7 W/m^2
The difficult part of this process is figuring out the fee
Re:So, that Global Climate Change exhibit... (Score:2)
Re:So, that Global Climate Change exhibit... (Score:2)
To refute your rising population=more body heat=warmer Earth hypothesis, I can figure out how much heat the human body puts out, multiply by the number of people (6.0E9) and divide by the surface area of the
Re:So, that Global Climate Change exhibit... (Score:2)
Re:So, that Global Climate Change exhibit... (Score:3, Insightful)
ok, let's go back 1000 years [noaa.gov] and then look at some model results. [nasa.gov] (graph in the middle of the page, the IPCC site is slow at the moment)
True, but on the grand scale of me, or a city, or a civilization, 140 years is quite a long time. And applying theories to data (and data to theories) is what science is all about). If you're doing historical science you can make a prediction about what you expect t
Re:So, that Global Climate Change exhibit... (Score:2)
hypothesis: Increasing CO2 in the atmosphere will warm the Earth (first proposed in 1895, by Svante Arrhenius [nasa.gov]
experiment: measure temperature and carbon dioxide, wait
result> CO2 and temperature both rise
fits your definition of the scientific process, no?
Re:So, that Global Climate Change exhibit... (Score:3, Insightful)
Of course we can sort out whether or not warming lagged CO2 or vice versa. We're burning a large (quantified) amount of fossil fuels. We also have an idea how much CO2 is moving i
Re:The science of bullcrapology... (Score:5, Informative)