New Science Museum - Now With Real Science!

OpenYourEyes writes "There is a new science museum, run by the National Academy of Science, that has opened in DC. So what? Unklike many museums which simplify their message or use fake data, the exhibits at the Koshland Science Museum are all based on real research, real reports, and real science. Each one contains references to the research reports and data they are based on. Exhibits on DNA, for example, use actual (and long!) DNA sequences to help illustrate how DNA plays a role in disease, agriculture, and criminology. There are also exhibits on Global Climate Change and The Wonders of Science."

And...

I have to wonder why we have SCIENCE museums that are based on anything else...

Scariest Thing

The Cafeteria includes things like "Bill Nye The Science Rie" sandwhiches.

Re:Scariest Thing

You can take advantage of their Perpetual Luncheon, though if the food is really bad, expect long lines at the washrooms as people experience Perpetual Motion.

Finally!

Finally! I've long outgrown the simplified explanations of the Boston Museum of Science (though it's still a lot of fun to visit) and the various science-related exhibits touring places like the Museum of Natural History in NY. Definitely putting this one down on my list of places to visit. Just because we're not in middle school anymore doesn't mean we lost that same curiosity...

My take..

Unklike many museums which simplify their message
I doubt they do this because they want to, think about it.. joe average would much rather see flashy presentations than boring old research papers. It's sad but true.. and museums have to do this in order to bring people in..

Re:My take..

I thought they called those places 'Universities'. ;-)

Re:What I'd like to see...

I remember when I used to watch THC and Discovery for their programs on a wide variety of things. Then came Discovery Wings, and I lived in glee for about a year as I watched all the Wings programs I had managed to miss because they couldn't keep a relatively constant schedule on the original channel. Now Discovery is all about redecorating your house and changing your wardrobe (with the occasional crime bit). Discovery Science still has the occasional neat deep-sea exploration, but for the most part, I am no longer able to take naps on the weekend bathed in the glow of useful scientific information.

THC still occasionally has some interesting things, and they have a knack for finding mundane things and making them interesting (like being able to be fascinated by an hour on the history of hand tools). Their library is starting to run thin, though, with more and more WW2 material showing up again (someone once referred to it as The Hitler Channel for its preoccupation with WW2 documentaries), and now they're turning too heavily towards commercial entertainment. I don't mind the occasional such movie (such as when they show "Tora! Tora! Tora!" while discussing the attack on Pearl Harbor), but it's turning into an open entertainment platform instead of the educational platform it could (and, IMHO, should) present.

Re:My take..

Hey, let's face it, most scientists and researchers would rather see flashy presentations than boring old research papers (at least outside of their areas of expertise).

I quick flip through the website shows that they still have a flashy presentation, but then you have the option of looking at further reading (both scientific journals and popular media) and other websites. This is a definite improvement and I think it may be the museum equivalent of making the source code available. ("Hey, we're not just BSing, take a look at the research that backs us up!")

Re:My take..

Something that most of the articles about this place have pointed out, but /. predictably failed to, is that this is largely designed for political purposes. The goal is to get lobbyists and senators to show up at this place, since they haven't the slightest idea what the hell these dnas are that everybody keeps talking about.

"This is not an artifact-based museum," Peter Schultz, the museum's exhibits and public programs director, told The Scientist. "It's focused on how science can better inform decision making." [biomedcentral.com]

It's not really aimed at the average joe, it's aimed at the guy that gets presentations on whether or not to fund some kind of genetic disease research project, or whatever. All the exibits are geared towards the sort of things beaurocrats have to deal with these days, but don't really understand. The exhibits rotate, but they all have a goal in mind. The first three are, respectively, to keep congress from going all knee-jerk on genetic engineering/promote the FBI DNA database, to get politicians to quit pretending global warming is imaginary, and to show off cool shit like dark matter so the NSF can get better funding next year.

My take on the subject

Well I didn't RTFA but I thought I would contribute this little bit...

How's about they stop trying to aim the entire museum [art, science, history] to 8 yr olds? I mean sure it's good to get kids into it but an entire museum that is just "ooh look, some teletubby speaking about physics!" is just pathetic and annoying.

Look, adults have money, kids don't. You want to make money for museum address the money.

As for art museums... STOP BUYING TRASH OF NO VALUE! Just cuz he has a goatee and a french cabaret doesn't mean he's an artist.

Tom

Re:My take on the subject

re:" Just cuz he has a goatee and a french cabaret doesn't mean he's an artist."

No that would mean he's a theatrical agent.

A Cabaret is a stage performance or more specificaly a theatrical revue. A BERET is a hat or something you wear on your head. Unless of course you can manage to balance an entire theatrical production on your head in which case you're a circus performer of the highest order of talent.

you take wrong.

Van Gogh, Gaugin, Toulouse-Lautrec, Whistler, Matisse - they were all considered "TRASH OF NO VALUE!" at some time in their career. Good thing the Dr. Gachets of the world don't listen to your ilk. Art is art, science is science. Leave money out of it, it has nothing to do with value.

Re:My take on the subject

All art, with the exception of that which contains valuable ingredients (gold jewelry, etc.), is essentially trash of no value.

The Mona Lisa is just a plank of wood with paint slathered on it. Rembrant's sculptures are just chunks of rock; hell I can get those for free.

Just because you don't like it doesn't mean it's not art. If a musuem paid a million dollars for something shiny, and it's the only one of its kind, then that's exactly what it's worth.

Covered on NPR

April 23rd on Talk of the Nation, Ira Flato spoke to Peter Schultz, the Exhibits and Public Programs Director.

Here's the obligatory link [npr.org]

Dumbing down is a good thing

Most people don't have interest in what's real and actual data. They want it condensed into a 5 minute visit to an exhibit. That condenstation often requires simplifying. Look at any blockbuster movie that has science in it. It's the same thing.

Re:Dumbing down is a good thing

I think you are underestimating people. Someone who has chosen to go to a Science Museum must have some interest in the subject, and want to find out more. Someone who simply wants to be entertained could think of dozens of more interesting things to do. You can't compare the science in a Hollywood film to the science in a museum. In one, the science is in the background; in the other, it is the main point.

If knowledge is presented in the right way, with plain English and interactive exhibits, why can't we also have the background, and references to actual research as well?

How long until they lose funding?

Isn't the governments position that global warming doesn't exist? That will be interesting, I live in a semi-artic area of Minnesota and I have noticed that it is much warmer now then it was when I was a kid. I remember many mornings waiting out for the bus when it was twenty+ below zero, and now we only see it that cold on alternating years, what gives?
I do have to admit that it got unusually cold for a few days this winter. It was difficult to even get my cigarette lit the day it was 35 below, I give props to the old Toyota though, it started just fine!

Minnesota's a lot warmer now

"That will be interesting, I live in a semi-artic area of Minnesota and I have noticed that it is much warmer now then it was when I was a kid."

I know. The snow used to be a lot deeper. When I was a 5 year old, snowbanks sometimes came up to the top of my head. Years later, it is hard to find snowbanks much more than knee-deep.

Climate Change

The section of their website on Climate Change was refreshing. No political or corporate sponsorship-motivated attempts to fudge the issue. No attempt to present something which is a consensus in the scientific community as a debate in order to make things more exciting. Just the facts, and evidence to back them up.

Good work!

Coo

I think this is a great idea! [Random_idea] Maybe even have an area dedicated to bleeding edge reports. Change the exhibit every month to keep the subject changing. [/Random_idea] However, I would also hope that they track the validity of such reports. It would suck to have such a valiant effort towards showing REAL science when the report used is falsified. (The guy who falsisfied reports and wasn't exposed until he was up for a nobel nomination is an example that comes to mind. Popular guy to use reports off of, but later proved false.)

Nuclear exhibit

I can't wait to see there exhibit on nuclear power, that'd be cool!

What's wrong with simplifying the message?

As a big fan of the St. Louis Science Center [slsc.org], I don't what's wrong with simplifying science for exhibits, especially when they're aimed at kids. I hear alot on Slashdot how America is being dumbed down and losing it's focus on science and industry. If science museums, while maybe slightly flawed, keep kids interested in science and help them gravitate towards science and engineering, what's the problem?

Huh?

Which science museums FAKE their data?
(I can understand simplifying it, but outright faking it?)

Re:Huh?

Which science museums FAKE their data?
(I can understand simplifying it, but outright faking it?)

How about explanations of potential energy? Have a ramp 3 meters high with a bowling ball on it. Let the bowling ball go. How fast will it be going once it reaches the bottom of the ramp? Well, calculate the potential energy of the ball at 3 meters. Convert that directly to kinetic energy to achieve a speed at the bottom. Put up a nice little chart for everybody to see. This would be fake data. Unless, of course, you account for friction between the ball and the ramp which uses some of that potential energy to overcome. The energy lost in getting the ball to rotate. Also consider air resistance, experimental error, etc.

Real science is putting up an exhibit where people can start the ball rolling and have the speed automatically calculated at the bottom. Let them do this three times and write down the end speed for each time. Then show why the speed isn't what typical calculations would give because of the reasons mentioned above. For hardcore science, teach them how to calculate the energy lost due to angular momentum, coefficient of friction between the ball and the surface, etc.

Washington DC

I do wish that we would spread these pieces all over the US. Right now, we place all the biggest meusums in D.C or Virginia. That means with one clean hit, all gone. Also, many ppl never make it to Washington (nor have a desire to go there), so they never get to see these treasures.

A bit OT... The Boerhaave Museum (Amsterdam)

Perhaps a bit off topic, but I recently visited the Boerhaave [museumboerhaave.nl], a great history of science museum, near Amsterdam.

Also a lot of fun was the History of Science Museum in Florence [firenze.it].

Science is not facts on parade . . .

I've long complained about science museums as childish, not giving science its full credit, and not giving the patrons a good understanding of the intricacies, complexity, and beauty of the scientific world. Of course I don't expect a museum to explain quantum mechanics in detail, but I do expect some idea of the evidence and data and perhaps a bit of the process that led us to the conclusion that we commonly accept as fact (After all we do call that the Scientific method).

So many museums have pretty diagrams showing "facts" but not much of the thinking that shows how we discovered and got to those facts (or conclusions or theories as the case may be).

Science is not facts. It's not bullets. It's not a list of terms describing a cross section of the earth. It's problem solving, experimentation, cross examination, peer review, drawing conclusions, making inferences, designing experiements . . . it encompasses higher thought processes than memorization of facts. Why don't most of the museums make an effort to show this?

3.14159...

I'm set to announce a Math museum based on real math. My first exhibit: a video on the calculation of pi. All of it. And none of this 22/7 crap or 3.14 stuff.

Yeah!

good things don't end with eum. They end with mania. Or teria!

Computer Exhibit

Maybe they will have an Exhibit on network technology and show the server load of a page linked to a slashdotting for all the inspiring network administrators to be.

#9000000!

Is really close! Can you feel it?

Wow! Actual DNA sequences!

Um... sorry, but how interesting is that?

There are 3 billion base pairs in the human genome.. any sequence short enough to be bearable for someone to look at without getting bored is going to be in there somewere.

Oh look at that.. in a normal person it's ATGTAAGTATAGCCTAGACTA and in the mutant it's
ATGTAAGCATAGCCTAGACTA.. how interesting!

Not really.. And I'm not saying biochem isn't fun, but looking at sequences, real or otherwise is about as boring as watching paint dry.

I wonder how many people would actually go to this

Most non-scientists don't go to museums because they want to learn what an RNA hairpin structure is, or to read up on the latest advances in quantum physics...they go to see something cool like some tool used by cavemen or a huge ass dinosaur skeleton. They may not learn stuff like how to draw carbon bonding to oxygen, but they do come away with more knowledge they came in with. The general public is more interested in their physical experience at the museum - where they can say "wow I just saw this new painting/fish/mummy and it was really incredible" not "hey I went to XYZ museum and learned the Heisenberg Uncertainty Principle!" Maybe this type of a museum has it's place, but most likely will not draw the huge crowds that most popular museums like the Smithsonian or American Museum of Natural History do.

Never understood obsession with "understanding"

I've never understood the obsession with "everybody must understand everything". By the time you're dumbing down the content for the lowest common denominator, you've got nearly nothing of substance beyond:

The magnets attract each other because of magic. We label this magic "magnetism". It's really complicated, but there are wizards who understand it. The magic is said to involve "poles", like the "north pole" and the "south pole", which is related to the north and south pole of the Earth in ways you can't understand. You now know nothing really about magnetism, but you can now sling around the labels "north magnetic pole" and "south magnetic pole" and sound like you understand something, just like the engineers on Star Trek! Speaking of which, here's a few pictures from Star Trek.

Now, I understand and totally agree that people can't jump from ignorance to Maxwell's equations, nor should they have to. And there's good reason to believe that Maxwell's equations are totally beyond most children (see developmental psychology; the cognitive skills necessary to understand calculus typically do not develop until the kid hits double-digits in the age).

On the other hand, why must the whole exhibit be geared at the introductory level? A museum is a big place. Surely at least a little bit of room could be spared for some more sophisticated information in parallel with the simplified stuff? 10-year-old and Dad ought to be able to learn something.

(I have a similar criticism of the educational system. Why should we expect every child to 100% master the same math? Instead, set a baseline, and include varying levels of math in the same lessons. Especially as you get into Algebra and beyond, it's increasingly easy to challenge your students while making sure everyone understands the baseline, even in the exact same classroom. The myth that every student should perform 100% on every assignment is one of the worst blocks to educational reform today. We should expect children to get things wrong... because next time they try, they'll do better, and next time, they'll do better, and next time, they'll do better, etc.... and those children end up way ahead of the ones confined to just what they can do ~100% the first time... and as we've seen, 100% perfection has a habit of receding over time, instead of advancing as we need.

It's all the same fallacy, playing out over and over again, museums, schools, college, television shows, everywhere.)

Hopefully few corporate spondsered exhibits

One of the things that always bothers me about so many science and technology museums is all of the exhibits that are skewed by the sponsorship. One example - the Fort Worth Museum of Science & History had an exhibit on the history of computer technology that was sponsored by IBM. The exhibits went into great detail on the technical innovations introduced by IBM. But somehow, the semiconductor just appeared out of nowhere sometime around 1960! There was no mention of Texas Instruments or Fairchild Semi anywhere.

Dumbed down?

Y'know, if most of the people who show up here on the climate change discussions even knew as much as the "dumbed down" museum pages, we could have a lot more sensible discussion of the topic.

The passive pages in the climate section were excellent. They found exactly the right words to express complex situations in clear, simple language, without skewing the importance in either direction. If you actually understand the situation you will understand how very carefully the words were chosen. Excellent job.

I tried one of their FLASH applets, though, and it was silly.

Take that GW Bush

Please tell me there's an exhibit on evolution.

Oops...

There goes your funding! Bush doesn't believe in climate change, or that kooky science thing for that matter.

Good Science Museum needed in DC

If anybody else has suffered through the *highly* politicized "Science in American Life" exhibit at the Museum of History in DC, you know what I mean. It featured--
1) a intricate diorama of two (white, male) 19th century scientists arguing about who got the credit for inventing saccharine,
2) control panel for a nuclear reactor, and some of the flash-ash images from Hiroshima,
3) blamed the invention of birth control pills for the decline of the American family,
4) the ONLY use for nylon they could come up with was ... nylon stockings.
Lots more in that vein. Not a single positive image of science or scientists in the whole thing. American Chemical Society paid 2 million to put that exhibit up, and were so furious with what had been done with their money they insisted their name be removed from it. Plenty of false information in *that* museum exhibit!

Real science. . ? Uh huh. Pull the other one.

There is vast knowledge living in the world today; knowledge which can blow open the shutters of the human mind and which is not being shared and which will certainly not be found in the halls of a public museum.

Big Government and big Corporate bodies lie and lie and lie. Keeping secrets is the name of the game! And who funds such extravagant projects as 'Halls of Science' and 'Museums'? When the Government will only tell you about the fighter jets it was building twenty years ago, and when Corporate America won't tell how it promotes illness through the food it sells with its Left hand, while promoting half-cures with the drugs it sells with the Right. . .

Oh, yes. These power bodies are certainly not going to hold anything back when they build a public brain-washing sanctum like a museum! (Sarcasm!)

Science is about the search for truth. So then what greater hypocrisy can you find than the Government/corporate funded 'science' museum?

"But they are not telling lies!"

Oh, but they are! A lie by omission, by inference. . . The most clever of lies work in the most clever of ways. Advertisers understand; The greatest lie sold by an advertiser is that people are not affected by advertising. --And there is no division here! These are the same people who build all the museums.

While a museum may delight us with examples of apple-on-the-head science in all its many glories, the broad picture painted is one of, "Here Is What We Clever Humans Know!" --A severely limited and false picture which so many people go away feeling great comfort and self-satisfaction in believing. Brain washing!

The universe is far more amazing than your keepers want you to know. But that's okay. Nobody can keep knowledge from you if you are determined to go and find it out for yourself.

Get out of the antiseptic halls of the museum and jump into the real world beyond. As the museum brochures claim, "There is so much to see and do, you can't possibly fit it all into one day!"

-FL

back to the roots!

First cheese crackers with real cheese...

Now a science museum with real science.

What's next? TV news with real news?

Sounds like America is experiencing a "back to the roots" movement!

The Pseudoscience Museum

http://www.answersingenesis.org/museum/

They are even going to have a recreation of Methuselah's hands!

Egad, fake science!

I *knew* the rolling ball at Boston Museum of Science couldn't really be doing all those clangs, bells, and chimes! There must have been a squirrel inside the ball to keep it moving, and a drummer at a drum set hidden behind the back wall!

SanFran Exploratorium != Science.

During my last visit to the Exploratorium (about 5 years ago), I remember seeing a display in which they had (behind a "closed casket" I guess so as not to scare little children) a complete human skeleton. In prominent letters it stated clearly that women have one pair less of ribs than men.
I'm not sure what medical textbook [bible.com] they are using, but I hope that my doctor doesn't use it.
I boycott the museum whenever I can since

The face of real science

The first exhibit to go in should be this one [wisc.edu], entitled "Electron Band Structure In Germanium, My Ass."

How does it compare?

How favorably, I'm left to wonder, is this science center compared to the one that's practically in my back yard [lsc.org]? I've been meaning to get there in the last five years that I've been living in Hudson County, NJ. An old geek friend I used to work with recommended it highly, stating emphatically to "bring your inner child" to this place.


My geek friend, was not a scientist, by the way. But she did tell me about a rather fascinating fact. It'd been a childhood dream of mine to attend spacecamp (having been inspired by the schocky movie of the same name). [imdb.com] And, yeah, I had the hotts for Lea Thompson! (hey, whaddya want? I was an 80's kid!). So, I wanted to go. It's my fave type of vacation...a learning vacation! BUT when I called, I was 16 years old. I was told (rather rudely, btw) that 15 was the cutoff age! NO SOUP FOR YOU!!! I was crestfallen.

But I was very glad when Camille (my geek friend's name) told me that SpaceCamp now has adult programs [spacecamp.com] that you can attend either with or without the kids in tow. It tends to attract brighter than average, professional adults, I'm told. Once I learned that, this venture DEFINITELY made my adult "to-do list".

Has anyone had experience with either of these learning programs, or insights to offer? I would love to know how complete and erudite either/both are. I see from the website, that SpaceCamp now has an "advanced" spacecamp for the returning adult! (seemingly!) TOO COOL!

Flame War! The Best Science Museum Is....

Some suggestions have already been posted but what science museum is worth taking a trip to a city just to see?

I grew up in Toronto and the Ontario Science Center [ontariosciencecentre.ca] was a favourite haunt.

Sadly I now live in Vancouver with only the pathetic Science World [scienceworld.bc.ca] and the ungodfully overpriced Space Museuem [hrmacmilla...centre.com].

Unk

> Unklike many museums which simplify their message
> or use fake data

Unk like free hookers and coke even better.

Give Unk a cookie.

Not dumbed down messages that make museums suck...

It's corporate sponsorships. Nothing worse than a bunch of exhibits that have been designed to embellish Lockheed Martin, Microsoft, et al.'s image. And you have to pay for your ticket, on top of that..

Re:More global warming pseudo-science

Not again...

Re:So, that Global Climate Change exhibit...

Will it be empty since there is no real empircal evidence of global warming?

No, it'll just be hidden behind the creationism exhibit, by executive order...

Re:So, that Global Climate Change exhibit...

The creationism exhibit looks a bit sloppy, like it only took six days to design and make.

Re:The science of bullcrapology...

I found your post amusing. I consider this /. story to be yet another -1, Troll. I used to work for a science museum. Never ran into any false stuff. If simplification is a crime then it should be reserved for *research institutions*. Science museums, on the other hand, serve only the casual public. Because of the obvious non sequitur and the red flag of "unlike other science museums...", I hope this thread has a quick death.

Re:So, that Global Climate Change exhibit...

So, what would you consider evidence of global warming?

I mean, I assume you don't dispute that the global average temperature [grida.no] has been increasing over the past few decades. So would you say that climatologists haven't proven that this is outside the bounds of normal climate variation? If so, what sort of evidence would satisfy you in this regard? Can you offer any data to show that this trend isn't significant?

Re:So, that Global Climate Change exhibit...

here's some "empirical evidence of global warming": http://www.giss.nasa.gov/data/update/gistemp/ and here's more: http://www.gsfc.nasa.gov/topstory/2004/0315skintem p.html

Re:another museum idea

They have one, it's called life. Haven't you figurd out that linux can run on damn near anything yet?