Forgot your password?
typodupeerror
Education Science

New Science Museum - Now With Real Science! 242

OpenYourEyes writes "There is a new science museum, run by the National Academy of Science, that has opened in DC. So what? Unklike many museums which simplify their message or use fake data, the exhibits at the Koshland Science Museum are all based on real research, real reports, and real science. Each one contains references to the research reports and data they are based on. Exhibits on DNA, for example, use actual (and long!) DNA sequences to help illustrate how DNA plays a role in disease, agriculture, and criminology. There are also exhibits on Global Climate Change and The Wonders of Science."
This discussion has been archived. No new comments can be posted.

New Science Museum - Now With Real Science!

Comments Filter:
  • And... (Score:5, Interesting)

    by Colonel Angus ( 752172 ) on Wednesday April 28, 2004 @03:25PM (#8999687)
    I have to wonder why we have SCIENCE museums that are based on anything else...
    • Re:And... (Score:2, Interesting)

      by lost_n_mad ( 521867 )
      I grew up around the Oak Ridge area. The science museum there was great. It was a wonderful balance between science and entertainment. There were two types of exhibits, real science and "wonder" science. While you could properly exhibit efficiency in a machine (all exhibits were hands on by the way, follow the steps which were based on the scientific method, and the results would be obvious to the observer) on some of the machines you could not, why you say? Because sometimes the principle for the experimen
  • by Anonymous Coward on Wednesday April 28, 2004 @03:26PM (#8999689)
    The Cafeteria includes things like "Bill Nye The Science Rie" sandwhiches.
  • Finally! (Score:5, Insightful)

    by Autumnmist ( 80543 ) on Wednesday April 28, 2004 @03:27PM (#8999714)
    Finally! I've long outgrown the simplified explanations of the Boston Museum of Science (though it's still a lot of fun to visit) and the various science-related exhibits touring places like the Museum of Natural History in NY. Definitely putting this one down on my list of places to visit. Just because we're not in middle school anymore doesn't mean we lost that same curiosity...
  • My take.. (Score:5, Insightful)

    by hookedup ( 630460 ) on Wednesday April 28, 2004 @03:28PM (#8999729)
    Unklike many museums which simplify their message
    I doubt they do this because they want to, think about it.. joe average would much rather see flashy presentations than boring old research papers. It's sad but true.. and museums have to do this in order to bring people in..
    • Re:My take.. (Score:2, Insightful)

      by Autumnmist ( 80543 )
      This is definitely true... but it's nice to have a least one museum geared to a more knowledgeable audience.
      • by Sqwubbsy ( 723014 ) on Wednesday April 28, 2004 @03:37PM (#8999844) Homepage Journal
        I thought they called those places 'Universities'. ;-)
      • by jdray ( 645332 )
        If this catches on, maybe the Discovery Network will sit up and take notice and start having programs for people who can think. DirecTV beams twenty-odd "educational" channels to my television, and I still spend a lot of time watching PBS that I could get for free.


        Okay, so maybe it's not "a lot" of time, but it's a significant amount. What I'd like to see is "television for people with three digit IQs." The current fare is distinctly lacking in that area.

        • by Martin Blank ( 154261 ) on Wednesday April 28, 2004 @04:11PM (#9000224) Homepage Journal
          I remember when I used to watch THC and Discovery for their programs on a wide variety of things. Then came Discovery Wings, and I lived in glee for about a year as I watched all the Wings programs I had managed to miss because they couldn't keep a relatively constant schedule on the original channel. Now Discovery is all about redecorating your house and changing your wardrobe (with the occasional crime bit). Discovery Science still has the occasional neat deep-sea exploration, but for the most part, I am no longer able to take naps on the weekend bathed in the glow of useful scientific information.

          THC still occasionally has some interesting things, and they have a knack for finding mundane things and making them interesting (like being able to be fascinated by an hour on the history of hand tools). Their library is starting to run thin, though, with more and more WW2 material showing up again (someone once referred to it as The Hitler Channel for its preoccupation with WW2 documentaries), and now they're turning too heavily towards commercial entertainment. I don't mind the occasional such movie (such as when they show "Tora! Tora! Tora!" while discussing the attack on Pearl Harbor), but it's turning into an open entertainment platform instead of the educational platform it could (and, IMHO, should) present.
    • Re:My take.. (Score:5, Insightful)

      by slackerboy ( 73121 ) on Wednesday April 28, 2004 @03:37PM (#8999850)
      Hey, let's face it, most scientists and researchers would rather see flashy presentations than boring old research papers (at least outside of their areas of expertise).

      I quick flip through the website shows that they still have a flashy presentation, but then you have the option of looking at further reading (both scientific journals and popular media) and other websites. This is a definite improvement and I think it may be the museum equivalent of making the source code available. ("Hey, we're not just BSing, take a look at the research that backs us up!")
    • joe average would much rather see flashy presentations than boring old research papers.

      Joe Average is going to be at the game, not hanging out in a science museum...

    • Re:My take.. (Score:4, Informative)

      by fenix down ( 206580 ) on Wednesday April 28, 2004 @04:15PM (#9000270)
      Something that most of the articles about this place have pointed out, but /. predictably failed to, is that this is largely designed for political purposes. The goal is to get lobbyists and senators to show up at this place, since they haven't the slightest idea what the hell these dnas are that everybody keeps talking about.

      "This is not an artifact-based museum," Peter Schultz, the museum's exhibits and public programs director, told The Scientist. "It's focused on how science can better inform decision making." [biomedcentral.com]

      It's not really aimed at the average joe, it's aimed at the guy that gets presentations on whether or not to fund some kind of genetic disease research project, or whatever. All the exibits are geared towards the sort of things beaurocrats have to deal with these days, but don't really understand. The exhibits rotate, but they all have a goal in mind. The first three are, respectively, to keep congress from going all knee-jerk on genetic engineering/promote the FBI DNA database, to get politicians to quit pretending global warming is imaginary, and to show off cool shit like dark matter so the NSF can get better funding next year.
    • Well do they really, or is that just accepted wisdom? My vote goes for deadly dull accepted wisdom. I've seen one museum after another abandon their core mission and turn into some bastardized version of tv/entertainment/museum. And the ones that don't, like the Barnes Foundation in Philadelphia, are sued out of existence by the very people who have decided to offer Bread and Circuses instead of Art.

      At some point someone has to say, well maybe we're doing more harm than good by going after the Average Joe
  • Covered on NPR (Score:5, Informative)

    by orange_6 ( 320700 ) <jtgalt@gmailDEBIAN.com minus distro> on Wednesday April 28, 2004 @03:30PM (#8999752) Journal
    April 23rd on Talk of the Nation, Ira Flato spoke to Peter Schultz, the Exhibits and Public Programs Director.

    Here's the obligatory link [npr.org]
  • Most people don't have interest in what's real and actual data. They want it condensed into a 5 minute visit to an exhibit. That condenstation often requires simplifying. Look at any blockbuster movie that has science in it. It's the same thing.
    • by Lurker McLurker ( 730170 ) <[allthecoolnames ... [at] [gmail.com]> on Wednesday April 28, 2004 @03:41PM (#8999901)
      I think you are underestimating people. Someone who has chosen to go to a Science Museum must have some interest in the subject, and want to find out more. Someone who simply wants to be entertained could think of dozens of more interesting things to do. You can't compare the science in a Hollywood film to the science in a museum. In one, the science is in the background; in the other, it is the main point.

      If knowledge is presented in the right way, with plain English and interactive exhibits, why can't we also have the background, and references to actual research as well?

    • "Dumbing down is a good thing"

      Yeah ... you're right ... lowering standards so people can meet those standards is a GREAT thing.

      WORDS TO HARD ... CAN I HAVE PICTURE, PUHLEESE??
  • Climate Change (Score:3, Interesting)

    by Lurker McLurker ( 730170 ) <[allthecoolnames ... [at] [gmail.com]> on Wednesday April 28, 2004 @03:33PM (#8999794)
    The section of their website on Climate Change was refreshing. No political or corporate sponsorship-motivated attempts to fudge the issue. No attempt to present something which is a consensus in the scientific community as a debate in order to make things more exciting. Just the facts, and evidence to back them up.

    Good work!

    • Let's see -- not one single (that I can find, anyway) suggestion that temperature fluctuations occur naturally, "average temperatures" with no explanation of the underlying period, a graph that suggests the planet came into being a hundred years ago and heavily disputed assertions about the role of CO2 presented as fact, with no evidence to back it up (again, that I can find).

      Sample quote:

      CO2 contributes more to the recent increase in greenhouse warming than any other gas. CO2 persists in the atmosphere lon

      • Heavily disputed by whom? The quote you chose is an accurate reflection of the scientific consensus.
      • Sample quote:

        CO2 contributes more to the recent increase in greenhouse warming than any other gas. CO2 persists in the atmosphere longer and longer as concentrations continue to rise.

        Other chemicals such as methane, nitrous oxide, and halocarbons also contribute to the global greenhouse effect. A number of additional chemicals related to urban pollution, such as low-level (tropospheric) ozone and black soot, can have a strong regional and perhaps global warming effect. Sulfate aerosols may have
    • Re:Climate Change (Score:3, Insightful)

      by Jerf ( 17166 )
      "Global Warming" is a debate, albeit a lop-sided one. The causes and ratios of climate change is a fierce debate. (Have humans had an effect? Oh, sure. But are they anywhere near 100% responsible? Now thats a much more inflammatory question. Personally, while I know humans aren't 0% responsible, people trying to put the number in, oh, say, the high 90%'s or even 100% I find much less compelling then those with lower ratios.)

      The inevitability of some change is not a subjuct of debate... except among some en
  • Coo (Score:2, Interesting)

    by shadowkoder ( 707230 )
    I think this is a great idea! [Random_idea] Maybe even have an area dedicated to bleeding edge reports. Change the exhibit every month to keep the subject changing. [/Random_idea] However, I would also hope that they track the validity of such reports. It would suck to have such a valiant effort towards showing REAL science when the report used is falsified. (The guy who falsisfied reports and wasn't exposed until he was up for a nobel nomination is an example that comes to mind. Popular guy to use reports
  • by newdamage ( 753043 ) on Wednesday April 28, 2004 @03:34PM (#8999806) Homepage Journal
    As a big fan of the St. Louis Science Center [slsc.org], I don't what's wrong with simplifying science for exhibits, especially when they're aimed at kids. I hear alot on Slashdot how America is being dumbed down and losing it's focus on science and industry. If science museums, while maybe slightly flawed, keep kids interested in science and help them gravitate towards science and engineering, what's the problem?
  • Huh? (Score:4, Insightful)

    by TCaptain ( 115352 ) <slashdot.20.tcap ... Mspamgourmet.com> on Wednesday April 28, 2004 @03:35PM (#8999810)
    Which science museums FAKE their data?
    (I can understand simplifying it, but outright faking it?)
    • I think there are very few museums that knowingly fake their data. There are, however, items in museum collections that have been shown to be fake, but were initially passed off as legitimate. (There are several examples where this happened with supposedly complete dinosaur skeletons that were actually assembled from multiple source animals.) Most of these are now just curiousities, but it raises credibility issues for museums in general. This new museum's technique of including references to "real scie
      • Actually, with your example for the dinosaur skeletons, 99% of them will be assembled from multiple sources.. It is extremely rare for complete dinosaur skeletons to be found - especially for the larger dinos.

        Of course, most of the displays (like the ones at the Smithsonian's Natural History Museum) are not the actual fossils. Way too much opportunity for damage in public displays.
    • Re:Huh? (Score:4, Interesting)

      by nacturation ( 646836 ) <nacturationNO@SPAMgmail.com> on Wednesday April 28, 2004 @04:04PM (#9000173) Journal
      Which science museums FAKE their data?
      (I can understand simplifying it, but outright faking it?)


      How about explanations of potential energy? Have a ramp 3 meters high with a bowling ball on it. Let the bowling ball go. How fast will it be going once it reaches the bottom of the ramp? Well, calculate the potential energy of the ball at 3 meters. Convert that directly to kinetic energy to achieve a speed at the bottom. Put up a nice little chart for everybody to see. This would be fake data. Unless, of course, you account for friction between the ball and the ramp which uses some of that potential energy to overcome. The energy lost in getting the ball to rotate. Also consider air resistance, experimental error, etc.

      Real science is putting up an exhibit where people can start the ball rolling and have the speed automatically calculated at the bottom. Let them do this three times and write down the end speed for each time. Then show why the speed isn't what typical calculations would give because of the reasons mentioned above. For hardcore science, teach them how to calculate the energy lost due to angular momentum, coefficient of friction between the ball and the surface, etc.
      • You can hand out a fucking B.S. when they leave the museum, because they'd spend about 4 years in there learning how to do all that shit. :P

        Museums are supposed to be fun, not hard work.

    • Which science museums FAKE their data?

      I think what they mean is that some of the charts and graphs displayed in an exhibit may not an original copy. The examples may have been sanitized to look better than they do in real research. For example gas chromatographs are a mess of peaks but graphs next to a display may show clear and definite peaks.

  • Washington DC (Score:3, Interesting)

    by WindBourne ( 631190 ) on Wednesday April 28, 2004 @03:36PM (#8999830) Journal
    I do wish that we would spread these pieces all over the US. Right now, we place all the biggest meusums in D.C or Virginia. That means with one clean hit, all gone. Also, many ppl never make it to Washington (nor have a desire to go there), so they never get to see these treasures.
    • Also, many ppl never make it to Washington (nor have a desire to go there), so they never get to see these treasures.

      Getting to Washington, D.C., is not exactly challenging, and while it can be expensive, it's one of the few cities in America where you can see the sights for next to nothing, if you plan properly.

      As for not having the desire to go there, well, we can't exactly bring the world to everyone's doorstep. Besides, it's easier to visit one place and see many great things than it is to visit man

      • Yeah, because never in the history of the world have invading marauders destroyed vast collections of knowledge.....

        tap... tap...
        Just once second...
        low whispering...

        Hmmm, it appears that maybe this has happened in the past, who knew!
  • by turnstyle ( 588788 ) on Wednesday April 28, 2004 @03:37PM (#8999855) Homepage
    Perhaps a bit off topic, but I recently visited the Boerhaave [museumboerhaave.nl], a great history of science museum, near Amsterdam.

    Also a lot of fun was the History of Science Museum in Florence [firenze.it].

  • by StateOfTheUnion ( 762194 ) on Wednesday April 28, 2004 @03:40PM (#8999882) Homepage
    I've long complained about science museums as childish, not giving science its full credit, and not giving the patrons a good understanding of the intricacies, complexity, and beauty of the scientific world. Of course I don't expect a museum to explain quantum mechanics in detail, but I do expect some idea of the evidence and data and perhaps a bit of the process that led us to the conclusion that we commonly accept as fact (After all we do call that the Scientific method).

    So many museums have pretty diagrams showing "facts" but not much of the thinking that shows how we discovered and got to those facts (or conclusions or theories as the case may be).

    Science is not facts. It's not bullets. It's not a list of terms describing a cross section of the earth. It's problem solving, experimentation, cross examination, peer review, drawing conclusions, making inferences, designing experiements . . . it encompasses higher thought processes than memorization of facts. Why don't most of the museums make an effort to show this?

    • by dpilot ( 134227 )
      S.F. reference - "Cycle of Fire" by Hal Clement. A primitive alien wants to better himself and his race, and gets the chance to freely study while associating with humans, with the sad realization that the new knowledge will be wiped before he's returned to his people.

      *** SPOILER ***

      But he was clever - while all knowledge was wiped, he managed to hang onto *the scientific method*, so he and his race could accelerate progress in the future.
    • It's even worse than that :-(. Have a look at this beautiful, glossy book for kids:

      How Science Works [amazon.com]

      That may be its title, but the book is all about temperature/pressure and rockets. That's like showing a sweater and saying "This is how knitting works."

      No wonder people are so scientifically illiterate.
  • good things don't end with eum. They end with mania. Or teria!
  • #9000000! (Score:2, Funny)

    by Anonymous Coward
    Is really close! Can you feel it?
  • Um... sorry, but how interesting is that?

    There are 3 billion base pairs in the human genome.. any sequence short enough to be bearable for someone to look at without getting bored is going to be in there somewere.

    Oh look at that.. in a normal person it's ATGTAAGTATAGCCTAGACTA and in the mutant it's
    ATGTAAGCATAGCCTAGACTA.. how interesting!

    Not really.. And I'm not saying biochem isn't fun, but looking at sequences, real or otherwise is about as boring as watching paint dry.
  • by pulse2600 ( 625694 ) on Wednesday April 28, 2004 @03:50PM (#9000024)
    Most non-scientists don't go to museums because they want to learn what an RNA hairpin structure is, or to read up on the latest advances in quantum physics...they go to see something cool like some tool used by cavemen or a huge ass dinosaur skeleton. They may not learn stuff like how to draw carbon bonding to oxygen, but they do come away with more knowledge they came in with. The general public is more interested in their physical experience at the museum - where they can say "wow I just saw this new painting/fish/mummy and it was really incredible" not "hey I went to XYZ museum and learned the Heisenberg Uncertainty Principle!" Maybe this type of a museum has it's place, but most likely will not draw the huge crowds that most popular museums like the Smithsonian or American Museum of Natural History do.
    • For me, one of the most impressive museum experiences was when I first saw a cloud chamber at the German Museum in Munich. To be able to actually "see" subatomic particles breaking up into other particles and leaving their trace in the mist, to be able to "see" those processes with my own eyes, was incredible. And to learn that scientists deduced much of the workings of our universe from such observations is fascinating!

      To me, this is clearly an example of real science that people can talk about at home.

  • by Jerf ( 17166 ) on Wednesday April 28, 2004 @03:52PM (#9000053) Journal
    I've never understood the obsession with "everybody must understand everything". By the time you're dumbing down the content for the lowest common denominator, you've got nearly nothing of substance beyond:
    The magnets attract each other because of magic. We label this magic "magnetism". It's really complicated, but there are wizards who understand it. The magic is said to involve "poles", like the "north pole" and the "south pole", which is related to the north and south pole of the Earth in ways you can't understand. You now know nothing really about magnetism, but you can now sling around the labels "north magnetic pole" and "south magnetic pole" and sound like you understand something, just like the engineers on Star Trek! Speaking of which, here's a few pictures from Star Trek.
    Now, I understand and totally agree that people can't jump from ignorance to Maxwell's equations, nor should they have to. And there's good reason to believe that Maxwell's equations are totally beyond most children (see developmental psychology; the cognitive skills necessary to understand calculus typically do not develop until the kid hits double-digits in the age).

    On the other hand, why must the whole exhibit be geared at the introductory level? A museum is a big place. Surely at least a little bit of room could be spared for some more sophisticated information in parallel with the simplified stuff? 10-year-old and Dad ought to be able to learn something.

    (I have a similar criticism of the educational system. Why should we expect every child to 100% master the same math? Instead, set a baseline, and include varying levels of math in the same lessons. Especially as you get into Algebra and beyond, it's increasingly easy to challenge your students while making sure everyone understands the baseline, even in the exact same classroom. The myth that every student should perform 100% on every assignment is one of the worst blocks to educational reform today. We should expect children to get things wrong... because next time they try, they'll do better, and next time, they'll do better, and next time, they'll do better, etc.... and those children end up way ahead of the ones confined to just what they can do ~100% the first time... and as we've seen, 100% perfection has a habit of receding over time, instead of advancing as we need.

    It's all the same fallacy, playing out over and over again, museums, schools, college, television shows, everywhere.)
    • On a completely unrelated tangent, I'm in Physics C (calc based physics), and I understand Maxwell's equations, but I couldn't even tell you why natural magnets cause the qv x b effect. As far as my teacher knows, that's just the way it is.
    • The myth that every student should perform 100% on every assignment is one of the worst...
      What are you talking about, not everyone is supposed to get 100%. Everyone is supposed to TRY and get 100%, but the test is made hard enougth that the mean is a B or a C. That is pretty standard for all education levels. There are always a few teachers who make their tests real easy, but generally it isn't a big problem
      • What are you talking about, not everyone is supposed to get 100%. Everyone is supposed to TRY and get 100%, but the test is made hard enougth that the mean is a B or a C. That is pretty standard for all education levels. There are always a few teachers who make their tests real easy, but generally it isn't a big problem

        No, that's the theory, a theory which is now being paid less and less lip service, let alone actually being implemented. Even so, if the system doesn't have built-in retries with the expect
  • by Ranger96 ( 452365 ) on Wednesday April 28, 2004 @03:52PM (#9000058)
    One of the things that always bothers me about so many science and technology museums is all of the exhibits that are skewed by the sponsorship. One example - the Fort Worth Museum of Science & History had an exhibit on the history of computer technology that was sponsored by IBM. The exhibits went into great detail on the technical innovations introduced by IBM. But somehow, the semiconductor just appeared out of nowhere sometime around 1960! There was no mention of Texas Instruments or Fairchild Semi anywhere.
  • Y'know, if most of the people who show up here on the climate change discussions even knew as much as the "dumbed down" museum pages, we could have a lot more sensible discussion of the topic.

    The passive pages in the climate section were excellent. They found exactly the right words to express complex situations in clear, simple language, without skewing the importance in either direction. If you actually understand the situation you will understand how very carefully the words were chosen. Excellent job.

  • Oops... (Score:4, Funny)

    by c0dedude ( 587568 ) on Wednesday April 28, 2004 @04:12PM (#9000233)
    There goes your funding! Bush doesn't believe in climate change, or that kooky science thing for that matter.
  • by BadCatRobot ( 690103 ) on Wednesday April 28, 2004 @04:24PM (#9000427)
    If anybody else has suffered through the *highly* politicized "Science in American Life" exhibit at the Museum of History in DC, you know what I mean. It featured--
    1) a intricate diorama of two (white, male) 19th century scientists arguing about who got the credit for inventing saccharine,
    2) control panel for a nuclear reactor, and some of the flash-ash images from Hiroshima,
    3) blamed the invention of birth control pills for the decline of the American family,
    4) the ONLY use for nylon they could come up with was ... nylon stockings.
    Lots more in that vein. Not a single positive image of science or scientists in the whole thing. American Chemical Society paid 2 million to put that exhibit up, and were so furious with what had been done with their money they insisted their name be removed from it. Plenty of false information in *that* museum exhibit!
    • I actually agree with the general sentiment here, but for the record:

      1) a intricate diorama of two (white, male) 19th century scientists arguing about who got the credit for inventing saccharine,

      Weren't most of the American (meaning from the US) scientist in the 19th century white males? Although it certainly doesn't reflect today's demographics, this sounds like an accurate representation of history.

      2) control panel for a nuclear reactor, and some of the flash-ash images from Hiroshima,

      Well, this s
      • You are quite correct on all points. The inaccuracy of the exhibit comes from not pointing out that few technical professions in the 19th century had members that were women or people of color, that birth control was a significant factor in women taking control of their lives (and reducing the risk of overpopulation), that radioisotopes are also used in the treatment of cancer, and that nylon (and similar plastics) are used in artificial joints. In other words, the exhibit had NO examples of positive aspe
  • by kavau ( 554682 ) on Wednesday April 28, 2004 @05:23PM (#9001179) Homepage
    First cheese crackers with real cheese...

    Now a science museum with real science.

    What's next? TV news with real news?

    Sounds like America is experiencing a "back to the roots" movement!

  • I *knew* the rolling ball at Boston Museum of Science couldn't really be doing all those clangs, bells, and chimes! There must have been a squirrel inside the ball to keep it moving, and a drummer at a drum set hidden behind the back wall!
  • During my last visit to the Exploratorium (about 5 years ago), I remember seeing a display in which they had (behind a "closed casket" I guess so as not to scare little children) a complete human skeleton. In prominent letters it stated clearly that women have one pair less of ribs than men.
    I'm not sure what medical textbook [bible.com] they are using, but I hope that my doctor doesn't use it.
    I boycott the museum whenever I can since
  • The first exhibit to go in should be this one [wisc.edu], entitled "Electron Band Structure In Germanium, My Ass."

  • How favorably, I'm left to wonder, is this science center compared to the one that's practically in my back yard [lsc.org]? I've been meaning to get there in the last five years that I've been living in Hudson County, NJ. An old geek friend I used to work with recommended it highly, stating emphatically to "bring your inner child" to this place.


    My geek friend, was not a scientist, by the way. But she did tell me about a rather fascinating fact. It'd been a childhood dream of mine to attend spacecamp (having been in
  • Some suggestions have already been posted but what science museum is worth taking a trip to a city just to see?

    I grew up in Toronto and the Ontario Science Center [ontariosciencecentre.ca] was a favourite haunt.

    Sadly I now live in Vancouver with only the pathetic Science World [scienceworld.bc.ca] and the ungodfully overpriced Space Museuem [hrmacmilla...centre.com].

"The urge to destroy is also a creative urge." -- Bakunin [ed. note - I would say: The urge to destroy may sometimes be a creative urge.]

Working...