Wikipedia To Host Human Gene Repository

schliz writes "US scientists are developing a 'Gene Wiki' with the aim of fostering a flexible, organic archive of human genetic information. The project exists within Wikipedia, and is expected to speed up the process of deciphering genome sequences."

I saw it on Wikipedia

[omnichad]

It says that gene #45A79 controls glowing in the dark! It must be true!

GATTA

[BadAnalogyGuy]

TAGGATTACACCT

Yo Yo I gots my GAT
rat a tat tat anotha nigga on his BAAACK

Steve W sucks cock! lol!!!1

16:04, 10 July 2008 86.75.30.9 (Talk) (3,808 bytes) (undo vandalism... maybe this shouldn't be a wiki)

Re:I saw it on Wikipedia

[voltel]

It says that gene #45A79 controls glowing in the dark! It must be true!

I for one welcome our new phosphorescent, dna-engineered overlords!

Re:Original research?

[omnichad]

Well...anyone can post a gene. That means more information, right? I've already made up 50.

Re:Original research?

[Dunbal]

This is all backwards and wiki should know better. The site will be more popular with less jeans.

Editing the Human Genome

[D Ninja]

Heh. The type of graffiti that will be put on these sites should be good. I can see it now...

Title: Bill Gates Genome
ATATCGGCGCGCTAVISTASUCKSATGCGCCGCGCG

Title: Linus Torvalds Genome
ATTATATACGYAYOPENSOURCETAGCCGCGATCG

Title: Cowboy Neal Genome
ATATCGGCCGGCGCGCATTATATATAIVOTEDFORNEALCGTAATAT

Re:What could possibly go wrong?

[jesdynf]

Well -- when you get right down to it, the human genome itself is full of errors, sloppiness, and outright sabotage, so I can't really think of a better host for it.

Re:I saw it on Wikipedia

[Anonymous Coward]

Wow, how the hell did you ever come up with that one? Was it all on your own, by your lonesome? Genius, man. Pure fucking genius! I don't know how you do it. No one ever expects a "I for one welcome our $ADJECTIVES overlords" on Slashdot of all places! Ha ha ha, what a laugh riot! You douchebag.

Oh, no you don't!

[Illbay]

I just KNOW that every time I post my genetic information up there, some wise-a** leftist is gonna "correct" it to give me more "compassion," "understanding," and "desire to eat foreign cuisine."

I'll be sitting there in my recliner watching The History Channel's week-long series on "Hitler's Secret Weapons" when I'm seized with an overwhelming desire to change the channel to "Oprah."

The Left rules Wikipedia; I'll be d*mned if there gonna get at MY genome!

Re:I saw it on Wikipedia

[voltel]

Like we're fooled Anonymous Coward! Your just trying to make yourself look good after that epic fail!

Re:Original research?

[Insightfill]

Should we start a pool on how quickly the project is tagged for speedy deletion due to lack of noteability?

Should we perhaps call it a gene pool?