Genome of DNA Pioneer Is Deciphered 142
unchiujar writes "The New York Times reports that the full genome of James D. Watson, one of the discoverers of the structure of DNA in 1953, has been deciphered, marking what some scientists believe is the gateway to an impending era of personalized genomic medicine. A copy of his genome, recorded on a pair of DVDs, was presented to Dr. Watson on Thursday in a ceremony in Houston by Richard Gibbs, director of the Human Genome Sequencing Center at the Baylor College of Medicine, and by Jonathan Rothberg, founder of the company 454 Life Sciences. 'The first two genome sequences belonging to individuals are now being made available to researchers within a few days of each other. One is Dr. Watson's and the other belongs to J. Craig Venter, who as president of the Celera Corporation started a human genome project in competition with the government. Dr. Venter left Celera after producing only a draft version of a genome, his own, in 2001, which the company did no further work on. He has now brought his genome to completion at his own institute in Rockville, Md., and deposited it last week in GenBank, a public DNA database, he said.'"
That's What They Think! (Score:1, Funny)
Excuse me Dr. Watson... (Score:4, Funny)
Limited Rights (Score:5, Funny)
Real Purpose (Score:1, Funny)
Just hope the DRM isn't cracked or people could clone my whole family, DAMN...Too Late
Re:Good result, disappointing scientist / human (Score:2, Funny)
Nature will find a way... (Score:3, Funny)
Re:Is that all I am? (Score:2, Funny)
Only six? (Score:4, Funny)
so you could fit almost 6 full humans on a DVD.
Only six? With lossy compression, you could do significantly better, as long as you don't mind all your offspring being funny-but-similar-looking lactose-intolerant non-deterministic sociopathic freaks.
Re:Is that all I am? (Score:2, Funny)
gttgaaatgggacgttgatggggtgatgtctgttcagtcttcgctgttt
Gesundheit.
Re:Is that all I am? (Score:3, Funny)
The Next Experiment (Score:3, Funny)
Or did that already happen? Are we part of the simulation, doomed to ever repeat our part in the story of Watson's life? It's like that Groundhog's Day movie on
Sorry, I'm very tired...
Re:2 DVD's? (Score:2, Funny)
I'm pretty certain most people don't want to see their very own "making of" documentaries...