Burn your genes on CD -- for $500,000 276
An anonymous reader writes "Venter says he plans to offer the service, with the goal of burning individual human's entire DNA sequences onto shiny compact discs.
It will cost about $500,000 per person, says the entrepreneurial scientist who helped decode the human genome. "
Consider the Savings (Score:5, Funny)
Watch out. (Score:3, Insightful)
Even though it's you, you know they will copyright it.
And even though it's you, you know they will prevent you from copying and sharing it.
Bad what people do for money.
Re:Watch out. (Score:2)
Re:Consider the Savings (Score:5, Funny)
Re:Consider the Savings (Score:2)
I wonder... (Score:2, Interesting)
Re:I wonder... (Score:2, Funny)
(Score:1, The Who Reference)
Re:I wonder... (Score:3, Interesting)
Re:I wonder... (Score:2, Informative)
linkage.rockefeller.edu/wli/dna_corr/music.html
I can't say that I tried them all
www.healingmusic.org/SusanA/order.html
Re:I wonder... (Score:2, Insightful)
Dude.. that's an Am7 chord. Your entire song is a "random arpeggio" through a single Am7 chord. Play it really fast and you've got.. an Am7 chord with a lot of vibrato on it.
I can't say I'm overwhelmingly impressed...
Re:I wonder... (Score:3, Interesting)
I'm a bioinformaticist- maybe I'll try this if I get bored some evening.
Re:I wonder... (Score:2)
repost (Score:2)
I carry my genes about with me everywhere anyway. (Score:4, Funny)
Re:I carry my genes about with me everywhere anywa (Score:2)
That's not the point? (Score:2)
Oh, the price has gone down. (Score:3, Informative)
Put one in space (Score:2, Insightful)
Re:Put one in space (Score:4, Insightful)
I think one would need reference info to put the code to use. It is kind of like having the machine code of an app without knowing the machine language.
Re:Put one in space (Score:2)
Now if you'll excuse me, I have a beam of light to catch...
Re:Put one in space (Score:2)
The Fly (Score:2)
Wow, this so much easier (Score:5, Funny)
Re:Wow, this so much easier (Score:4, Funny)
RIAA (Score:3, Funny)
Re:RIAA (Score:3, Funny)
the ultimate insult (Score:5, Funny)
"gee, if im using your genetic sequence to keep my desk clean, chances are i dont really care for your opinion either, huh?"
Alright, start the clock... (Score:2)
some questions (Score:3, Interesting)
1) What keeps them from exploiting your DNA for their profit? Suppose they discover something profoundly unique about your DNA that has significant medical implication. Who has the rights to that information?
2) How is the information encoded on the CD? Is it proprietary or some kind of de facto standard? (Oh, so you want to use the information? We'll have to read that for you! $100,000 per reading!)
3) CDs last forever right? Thirty years from now I'll be able to use the information on that CD, right? Didn't think so.
Re:some questions (Score:3, Interesting)
Re:some questions (Score:2)
Seriously, the research crowd tend to use simple and open file formats. No need to worry.
Re:some questions (Score:3, Interesting)
Nope. Won't fit.
The Human gene set holds about 3 billion acid pairs. Thus you'd need a file of about 3 gigabytes to hold it in plain ascii. The file holds only 2 bits per byte, so can trivially be compressed to 600M, but gzip is very likely able to do much better.
#include
int main (int argc, char **argv)
{
int ch;
char ACGT[] = "ACGT";
while ((ch = getchar ()) != EOF) {
putchar (ACGT[ (ch >> 0) & 0x03] );
putchar (ACGT[ (ch >> 2) & 0x03] );
putchar (ACGT[ (ch >> 4) & 0x03] );
putchar (ACGT[ (ch >> 6) & 0x03] );
}
exit (0);
}
Regards,
Roger.
Ventner is suspect already... (Score:4, Interesting)
CD? (Score:2)
Re:CD? (Score:2)
Because the t-shirt folks aren't doing anywhere close to your entire genome, they state this right on the page you linked to, and a listing of 3 billion base pairs would have to be so small as to be unreadable, no matter HOW large your t-shirt size.
Wouldn't surprise me at all if 'funDNA protocols' just ignores anything input, and outputs random letters - how is the buyer going to confirm or deny it?
Post Your Genes on Slashdot - $0 (Score:3, Funny)
atgcgcctagtttatagcgagcgtatgctgatcagtctggtatgg
Re:Post Your Genes on Slashdot - $0 (Score:5, Funny)
According to this, [harvard.edu] you are going to die from insanely shortened chromosome #1 any second now.
Re:Post Your Genes on Slashdot - $0 (Score:2)
What I wanna know is... (Score:4, Funny)
Re:What I wanna know is... (Score:2)
Why a CD? (Score:4, Funny)
Cooking Recipe. (Score:5, Funny)
burning individual human's entire DNA sequences onto shiny compact discs
I can do that for less than $500k:
Ingredients:
One CD (make use of an AOL one for a change).
A skin or blood sample.
Preperation:
Put all the ingredients into a casserole dish, preheat oven to gas mark 9. When ready place casserole dish into oven and leave until black acrid smoke comes out of the oven. Et Voila, your DNA 'burned' onto a CD.
A nice keep sake for years to come! And as Nigella Lawson would say, "Absolutely Scrumptious"!
Value (Score:3, Funny)
Now I just have to sell my stock in Venter's enterprise to affod it --- oh wait: I OWE 500 grand on ledger. Silly me!
Cheers,
Re:Value (Score:2)
Actually, it's around $16 per gene... still not too bad.
Great business plan (Score:2)
foreach $criminal (@fbiTopTen) {
1. Download $criminal iso image from Kaaza
2. Clone
3. Put $criminal in enhanced growth chamber.
4. Get Lunch
5. Take $criminal to FBI and collect ransom
}
Profit!
Re:Great business plan (Score:2)
By the time this could conceivably useful... (Score:2)
Broken Time Machine (Score:2)
Presently the only good potential customer I could see would be the one that dreams on making a copy of himself when medicine gets to advanced to achieve what can't do today. This thing goes on the same wave as the frozen cadavers, frozen human cells and the frozen human DNA. However we know that all this risk to degrade in time. So the idea of writing up one's DNA would be an intersting solution to these drawbacks. Is it?
No. Because CD are also not eternal. And besides there is a huge difference between genes and what comes up after. We humans are the less genetic species on Earth, and every detail on character, behaviour and knowledge is mainly a product of our everyday experience. We are formed under the circumstances we grow up, the conditions of our family, society and the world in the whole. Besides every single piece of experience can be very fundamental to our character.
Let's remeber an old tale that many people used on several SF tales - Adolf Hitler's clones. Would Adolf Hitler revive from his genes? Absolutely not. His copies wouldn't ever seen his strict mother and his father with that very character of an austriac small burocrat. He wouldn't have suffered that poisoning in Ypres battlefield and wouldn't have seen the turmoil of the Russian October Revolution beating on the doors of Germany. He would not be the same racist bastard because his antecessor managed to wipe out a good piece of Jewish population in Germany and this populistic view that "jews are to be blamed for everything" is hardly to be overused today. Who would really be the new Adolf Hitler is hard to predict. However I would believe that his fate would not be shinny. Because he would not have parents, his artificiality would probably hunt him for the rest of his life and society, with its stupidities, faiths and superstitions would always mark him as the "Butcher of the World".
Well, probably soon we will have "an holographic image of your brain on DVD" together with instructions to reproduce it... But even then I would hardly believe that anyone may get ready for eternity. What would happen if I suddenly travel 1000 ahead from now? Well, let's take someone 1000 before us, and think the SHOCK he would get:
Boxes showing people or talking.
Mettalic tubes that spit fire and make huge thunders.
Big metallic things that move without horses, some EVEN FLY like birds.
People talking to each other on distance.
Fire that burns without wood.
Some strange boxes, made of metal and something like glass, where people write some strange symbols that look like letters and pass huge amounts of time on them. Some of these boxes even play songs or seem to talk. Others show demons, dragons and even trolls.
In other terms - The Hell...
Re:Broken Time Machine (Score:2)
Being frozen for 1000 years and waking up in the year 3000?
I think I've watched enough Star Trek to get along. I'd probably find some decendant to leach from...
Then again, I'm just some pizza parlor dude, what do I know?
Re:Broken Time Machine (Score:2)
Does anyone know how to do freaken back-ups any more? Has everyone forgotten how to copy CDs?
Does the word CD suddenly put most people's brain into a mode where they forget the fundamental concepts of digital media?
Seriously....Whenever "CD" and "back-up" are mentioned in the same aritcal, there's always about 20 posts along the lines of "CDs only last XX years", "But who would still have a CD-ROM in XX years time?", "By that time...".
But... (Score:2)
Guarantees of accuracy? (Score:2)
It's too bad (Score:2, Funny)
I can do better (Score:2, Funny)
Re:I can do better (Score:2, Funny)
Why? (Score:4, Funny)
Backup (Score:5, Funny)
Re:Backup, bad pun (Score:2, Funny)
End of the chain (Score:2)
Try before you buy. (Score:2)
Flaming (Score:2)
Hehe (Score:2, Funny)
Oh what fun.
anyone serious about preservation... (Score:2)
In ten years time the technology to sequence quickly will allow for this operation to be done at 1% of today's cost. (Yes, I will put money [longbets.org] on that prediction.)
Of course when the time comes, if you really want to keep the sequence a long time, I wouldn't suggest CD-ROM. With a shelf-life [dtic.mil] of 50-200 years under optimal conditions, you'd be better with a book printed on acid-free paper. There you're looking at a shelf life of half a millenium or more under the same conditions.
Movie synopsis from the year 8,372,002 (Score:2)
When the experiment goes awry, a young female tourist saves the day with her knowledge of Unix workstations*.
*UNIX is a registered trademark of William H. Gates DCXVII
Huh? I AM a CD. (Score:2)
Re:how big is the entire genome? (Score:2, Informative)
Sources say there's about 3 billion base pairs in the human genome. If we assume a reasonably efficient encoding scheme, we can get 4 base pairs into a normal 8-bit byte without compression. This gives us a total data size of a little over 700 megabytes, uncompressed. Run it through gzip, and you could probably fit it onto one cd, definitely 2.
encoding vs. compression (Score:2)
You're confusing encoding with compression. Something composed from an alphabet of 4 letters is already essentially encoded in base 4, and can be encoded in binary using 2 bits per letter.
How much you can compress the resulting bit stream completely depends on the nature of the data, and without knowing something about the actual data patterns in the genome, it's not really possible to know in advance how much it'll compress.
Re:how big is the entire genome? (Score:2, Insightful)
Re:how big is the entire genome? (Score:2)
http://www.ncbi.nlm.nih.gov/UniGene/
and as for the poster 2 up -- over 98% ov genetic material between humans is the same. current estimates are that only 30-50megabases differentiate any one huamn from another.
Re:how big is the entire genome? (Score:5, Informative)
This website [ornl.gov] says that we have about 3 billion base pairs, 30 thousand of which are genes (the rest is the mysterious "junk dna"). There are 4 base pairs, therefore each base pair is 2 bits of data. That's about 7.5kb for all the genes, and 715MB for every base pair - which after compression should fit comfortably on a standard CD.
Re:how big is the entire genome? (Score:2)
You couldn't even make a bacterium with 30 kbp of coding sequence.
Re:how big is the entire genome? (Score:2)
- This website [ornl.gov] says that we have about 3 billion base pairs, 30 thousand of which are genes (the rest is the mysterious "junk dna"). There are 4 base pairs, therefore each base pair is 2 bits of data. That's about 7.5kb for all the genes, and 715MB for every base pair - which after compression should fit comfortably on a standard CD.
Thanks for doing the calculation. Kind of magical in several ways:- Even including the junk - not very much by today's information-processing standards. Given some outrageous tech, it would be possible to re-create "a" human race with ten or twenty CDs.
- Talking about outrageous tech: a CD full of information squashed together in a space it takes an electron microscope even to see. We have some catching up to do
Re:how big is the entire genome? (Score:2)
Re:how big is the entire genome? (Score:2)
I think part of the problem is that DNA has to accomplish a lot of tasks. It has to mutate at just the right rate, it has to be pretty durable, it has to carry data, it has to be regulatable, it has to fit inside a confined space, and it probably has to do a lot of things nobody has thought of yet. Bacteria and viruses go for the most coding DNA in the smallest space. Eukaryotes go for the most versatility. Having all that non-coding DNA is a bit of a luxury when you think about it, but eukaryotes aren't driven by efficiency. Maybe a megabase of seemingly repetitive DNA convers a very slight advantage - maybe due to the physical structure of the DNA, or maybe due to the ability to implement a fancy regulatory system using it. For a bacteria, a megabase of extra DNA would be unthinkable unless it conferred a tremendous advantage. For eukaryotes, the cost of having that DNA is much lower, and so you are more likely to keep it around in case it comes in handy.
Picture these scenarios:
1. You live in a 2 bedroom apartment with a wife and three kids. Property costs a fortune in the area - you couldn't get more space without paying a FORTUNE for it.
2. You live in Bill Gate's house. Land costs 1 cent per acre, and you can build a 500,000 square foot warehouse for $29.95.
If you live in world #2 - would you ever throw anything out that didn't smell? Just the remote chance that it could come in handy later would make things worth saving. Somebody who purused your warehouse might not be able to figure out what some of that stuff is for - you don't seem to use it at all. You know what it is for, but you don't use it since you replaced it with something better years ago and are only keeping it since it doesn't cost you anything.
If you lived in world #1 there would be nothing in your house which isn't absolutely essential. Anybody who studied your house would figure out pretty quickly what everything is for. After all, they could see how you use it every day.
Re:how big is the entire genome? (Score:2)
This of course brings up a different possibility - watching your gene map on TV. Dark room, techno music, maybe a little beer - quite the show.
Re:how big is the entire genome? (Score:2)
We're assuming lossless compression, right?
Don't want to lose any important bits....:)
Re:how big is the entire genome? (Score:2)
Until we become collectively aware of its purpose, anyway.
Re:how big is the entire genome? (Score:2)
Re:how big is the entire genome? (Score:5, Informative)
Re:how big is the entire genome? (Score:2)
Re:how big is the entire genome? (Score:2)
I guess the obvious snide in joke to make here would be that since Venter's talking about this, we can assume that everyone who goes for this will end up with quite a few N's in their sequences. (sorry, I've heard a few too many Cato Institute types use Celera as an example of why we should eliminate the NIH. morons.)
Re:how big is the entire genome? (Score:2)
Re:how big is the entire genome? (Score:2)
Say what? (Score:2, Informative)
Re:Say what? (Score:2)
That's a bit incomplete. The helix itself isn't made of those chemicals; it's some kind of protein structure.
The original poster actually makes a valid argument, but only if the subject receiving the CD is not familiar with genetics. In other words, if we put the CD in a time capsule, and then wiped ourselves out with biological warfare, and then the Earth was resettled by aliens 150 million years later, then even if they knew the CD was full of some kind of genetic information, they wouldn't be able to recreate a human without some additional knowledge. Consider receiving the world's first MP3, being told it was "a song", and being asked to write a player. Now, think of something several orders of magnitude more difficult. Yeah, that's about right.
But even if he makes a valid point, it's not necessarily a very relevant one, since I see no compelling reason to care what happens to the universe after our species is extinct...
Re:You have it backwards... (Score:2)
Re:Say what? (Score:2)
Re:One flaw, not everything is on the CD. (Score:2)
What are you talking about?!?!? (Score:2, Informative)
As another person who replied to this, I'd like to reiterate that the chemical composition of DNA is known. Composed of four different nucloside triphosphates (GATC) in an dynamically ordered structure.
If I follow your train of thought, than all of genomes that are sequenced are worthless to me and the scientific community because we aren't "the same company who made the CD".
Look here [nih.gov] at the National Center for Biotechnology Infortaion's Genomic Database. I'd assume you would receive something similar to this from Venter's group.
Also one can FREELY browse the human genome [nih.gov] and look for differences between your genome and those used to construct this draft of the genome.
Midochondrial DNA not on CD; DNA not whole story (Score:2, Informative)
More speculatively, there may be other things we dont know about yet that get a free ride from mother to child. To be very speculative, certain protein sets might very well influence the exprression of your genome. That is to say different developement.
This is not an unreasonable hypothesis, despite its high degree of speculation. Your and my Genonomes are so similar it is reasonable to suppose our differences arrise in part from HOW the genese are expressed. Expression is regulated by proteins in the cell that contains the DNA. Thus implanting your genome in another cell might not produce the same phenotype individual despite the common DNA.
Midochondrial diversity (Score:2)
Re:Will it fit? (Score:2, Insightful)
Q. How big is the human genome?
The human genome is made up of DNA, which has four different chemical building blocks. These are called bases and abbreviated A, T, C, and G. In the human genome, about 3 billion bases are arranged along the chromosomes in a particular order for each unique individual. To get an idea of the size of the human genome present in each of our cells, consider the following analogy: If the DNA sequence of the human genome were compiled in books, the equivalent of 200 volumes the size of a Manhattan telephone book (at 1000 pages each) would be needed to hold it all.
It would take about 9.5 years to read out loud (without stopping) the 3 billion bases in a person's genome sequence. This is calculated on a reading rate of 10 bases per second, equaling 600 bases/minute, 36,000 bases/hour, 864,000 bases/day, 315,360,000 bases/year.
Storing all this information is a great challenge to computer experts known as bioinformatics specialists. One million bases (called a megabase and abbreviated Mb) of DNA sequence data is roughly equivalent to 1 megabyte of computer data storage space. Since the human genome is 3 billion base pairs long, 3 gigabytes of computer data storage space are needed to store the entire genome. This includes nucleotide sequence data only and does not include data annotations and other information that can be associated with sequence data.
As time goes on, more annotations will be entered as a result of laboratory findings, literature searches, data analyses, personal communications, automated data-analysis programs, and auto annotators. These annotations associated with the sequence data will likely dwarf the amount of storage space actually taken up by the initial 3 billion nucleotide sequence. Of course, that's not much of a surprise because the sequence is merely one starting point for much deeper biological understanding!
Contributions to this answer were made by Morey Parang and Richard Mural formerly of Oak Ridge National Laboratory; and Mark Adams formerly of The Institute of Genome Research. [01/01]
Re:Me for sale! (Score:2)
Re:Digital Life? (Score:2, Redundant)
first of all, we are talking about genotypes and not phenotypes (phenotypes are impossible to put on CD for obvious reasons). secondly, the human genome is roughly 3 Giga Basepairs, which, if you consider that you need 2 bits to store one basepair, gives you just over 715MB, with some compression that happily lives on a CD.
Of course the vast (vast) majority of that is identical for all people, so you only need to store the differences.
Reality Check (Score:2, Insightful)
Re:Consider This... (Score:2)
Interesting, interesting....
AFAIK, chimpanzee DNA has never been fully sequenced(?). Comparisons have probably been made using simpler DNA typing procedures.
However, by now we have at least two complete human DNA's. Has anyone run a diff on them to determine exactly how much difference there is between two not exactly random but anyway humans? Assuming the DNA is 99.9% identical, your chromosomal uniqueness (stored as a diff from some Standard Human DNA) should fit on a single floppy!
Heck, using this scheme, you should be able to store the DNA code of every single human being alive in < 10 PB, soon within reach of SAN storage clusters. The mind boggles... Of course, that would cost < $5e15 with current pricing. Maybe I can get a volume discount.
BTW, is anyone working on mapping mitochondric DNA? How large is that, anyway?
Re:Consider This... (Score:2)
Chimp DNA is being worked on right now; not sure of the ETA, but you can be certain that this will make a big splash when even a draft sequence is released. Most comparison made between chimp and human DNA so far have either been simple hybridization experiments, or comparisons of tens (now hundreds) of genes sequenced in both species. The short story is: wow, these genomes are close, but on the other hand we are *rather* different from chimps in many ways that matter quite a lot.
Re:Albert Einstein's Genome exists! (Score:4, Insightful)
Actually it's pretty unlikely, I would guess. It depends strongly upon how the brain has been preserved - if it's in a strong formalin solution then the DNA is largely unrecoverable. There are methods for getting some DNA out of formalin-fixed tissue, but it wouldn't be an easy job.
I don't think the information would be a lot of use anyway until a LOT more is understood about brain development, and that's still assuming that whatever made Einstein's brain so brilliant was completely genetic in anyway. In utero environmental factors and probably lots of other factors we don't even know about yet might play a role. Make a complete DNA copy of Albert and you might just end up with an unusually bright kid, but not a world-class genius.
Re:Copyright? (Score:2)
I would be REALLY surprised, as his name is J Craig, not Greg.
sorry, I couldn't resist.
Re:What kind of special features will I get on DVD (Score:2)
Pop in your CD and one from a potential mate -- then push the button and have the software generate the array of potential vital stats on offspring. propensities, diseases, height and weight, correlations. as long as I'm dreaming, a good face shot too would be nice too.
it's a long way off. probably not in my lifetime, but it'll be here within 100 years.