Stories
Slash Boxes
Comments

News for nerds, stuff that matters

Slashdot Log In

Log In

Create Account  |  Retrieve Password

DNA-Radio, Tune In To Your Chromosomes

Posted by samzenpus on Wed Mar 04, 2009 11:46 PM
from the because-we-can dept.
An anonymous reader writes "The folks behind the DNA-Rainbow project (discussed on Slashdot before) apparently have some time to play around with genome data. After creating amazing pictures from the human DNA code they are now transforming all chromosomes to audio and streaming them to the Internet. Every base is read and broadcasted instead converting it to a color. Seemingly this artistic project will last a while. After some math they found out that it will take them more than 23.5 years to air the whole human genome sequence."
+ -
story

Related Stories

[+] DNA-rainbow, A New Vision of Human Chromosomes 161 comments
An anonymous reader writes "Two scientists have rendered amazing pictures using datafiles from the human genome project. They assigned different colors to the DNA and rendered images showing interesting patterns and strange structures of our chromosomes. It might be a groundbreaking new idea for displaying and maybe better understanding our genes. With its fascinating pictures it is a beautiful mix of science and art."
This discussion has been archived. No new comments can be posted.
The Fine Print: The following comments are owned by whoever posted them. We are not responsible for them in any way.
 Full
 Abbreviated
 Hidden
More
Loading... please wait.
  • by Praedon (707326) on Wednesday March 04 2009, @11:51PM (#27073603) Journal
    I for one welcome our robotic chromosome reader overlord. Cause it's going to know everything about our DNA, so it's important to n... CCCCCCAAGGCCCCAACCCAAAACCCCGGCCGGTCCATTCAA
    • Re:CCCCCAGCAAGCCCA (Score:5, Interesting)

      by !coward (168942) on Thursday March 05 2009, @12:04AM (#27073683)

      I was actually a little disappointed when I heard the feed.. Hadn't expected it to be just a robotic reader spelling out the sequence.

      Thought they might have just used the fact that three of the bases start with letters that are also musical notes in the english notation (A, C and G).. Choose a suitable 4th note for Thymine (maybe E, its last letter) and then run it through a midi sampler..

      To spice it up, they could do some fun stuff with combinations, for example altering the tempo when you found repetitions of the same base, something for sharp/flat (just to mix it up a bit), etc..

      Maybe not the point of this experiment (well, if you can call it that -- this isn't exactly science anyway), but as with the previous graphics experiment, it might even produce some interesting tune somewhere down the line.

      As it is, though a nice code hack I'm sure, the result is a tad boring.

      • It could be interesting to play all three members of each base triplet simultaneously, in three different octaves, one "chord" after another. This might even help researchers listen for specific amino acid combinations, which some people might find easier than reading row upon row of CCATGCCAAGAT.

        The triplets might also be translated into different chords not directly related to the A minor 7 chord (A C E G). This would help when two bases of a triplet are the same, as it is generally more difficult to hear

    • Your comments are pure CACA you GAT! You have as much TACT and a rubber CAT with a GATTACA TAT.
  • Nice. (Score:4, Insightful)

    by Creepy Crawler (680178) on Wednesday March 04 2009, @11:52PM (#27073613)

    So now, YOUR dna isnt just covered be somebody else's patents, but now your DNA is someone else's copyrights.

    • That wasnt supposed to be funny.

      This is the result when one attempts to "reform patents", as we see in a prior article. Remember that patents only have a life of around 17 years. Copyright is, what, 150 years or so, if owned by a corporation. If the corps cant own it via patents, they'll own it via copyright. It's simply the Tragedy of the Anticommons., and was guessed if patent rights were, or perceived to be weakened.

      -- a poem from the opening of Distress, by Greg Egan

      It is not true that the map of freed

    • Re:Nice. (Score:5, Funny)

      by dwywit (1109409) on Thursday March 05 2009, @12:11AM (#27073735)
      Hence - all your base are belong to us!
    • Hmm... Imagine the possibilities:

      Like, a couple want to have kids, but they have to pay for a "DNA combination license" prior to the conception.
      Since sex carries the risk of conception, even non-conceptive sex will need a proper authorization and a ID (specifying, among other things, sexual orientation). Gay people don't like that and say it does not apply to them, but so is the law.

      Parents would not only worry with feeding, paying school etc. There will be a regular tax which would go to a R
  • Douglas Adams (Score:4, Informative)

    by GrahamCox (741991) on Wednesday March 04 2009, @11:55PM (#27073635) Homepage
    Douglas Adams (also DNA) used this idea in one of the Dirk Gently books - turning arbitrary data into beautiful audio. Then again he may have nicked it from Brian Eno, who was also talking about something similar in the 70s.
    • Re:Douglas Adams (Score:4, Informative)

      by v1 (525388) on Wednesday March 04 2009, @11:58PM (#27073647) Homepage Journal

      I was hoping they'd be playing some sort of music created from the sequences. listening to some monotone voice recite letters of the alphabet ad-nausium isn't going to attract anyone

      • Re:Douglas Adams (Score:4, Informative)

        by clang_jangle (975789) on Thursday March 05 2009, @12:06AM (#27073691)
        Agreed, it's very disappointing. I guess samzenpus calling it an "artistic project" in TFS set me up to expect more. Wonder if he actually lisened to it? Here's a direct link [dna-rainbow.org] to the stream, for sam and whomever else wants to hear.
      • Re:Douglas Adams (Score:4, Informative)

        by Amouth (879122) on Thursday March 05 2009, @12:07AM (#27073697)

        to be honest i was thinking the same thing.. after seeng some of the patterns in the image versions i was wondering if they where going to take either the individual pairs and match them with and instrament or have one modify the other or something - kinda like the network analyser that turns logs and box loads into clasical music..

        if they did that and it was remotely nice to listen to.. i would have it book marked - but after 30seconds of that thing i will never touch it again except maybe to troll someone

    • John Cage wasn't just talking about it, he was doing it (including radios and other aleatory elements in his performances) back in the 1940s.

  • "After some math they found out that it will take them more than 23.5 years to air the whole human genome sequence."

    And yet it'll still be torrented.

  • It is actually just some kid with a broken Speak & Spell.
    • It's not broken. It's been given to a two-year-old. Parents of two-year-olds can back me up on this one.

      ("would you please stop pushing that same f@%*#&$ button!?")

  • I don't get it... (Score:3, Insightful)

    by iluvcapra (782887) on Thursday March 05 2009, @01:04AM (#27074023) Homepage

    It sounds like a numbers station, but at that it's still not very useful.

    The problem with this and DNA-rainbow is that it doesn't transform the domain of the raw base pairs into a domain of human vision (or audition) in such a way that actual higher-order patterns occur. We take long strings of tabular numbers that have no pattern at all and transform it into a beautiful curve, and this gives us insight into what the numbers may mean, what they may do in the future, etc. But this stuff adds nothing to the noisy junk it's built on... imho

  • Numbers Station (Score:3, Interesting)

    by Penguinshit (591885) on Thursday March 05 2009, @01:06AM (#27074043) Homepage Journal
    It's the ultimate numbers station! [wikipedia.org]
  • Just as interesting as looking at the base pairs... which isn't very. Someone needs to put this into Songsmith somehow.
  • Karma be damned! That was hella lame. I want my 12 seconds back.
  • I did a dna to sound project as a graduate student that actually played notes for a given chromosome. In fact I created an entire virtual orchestra (multiple machines) that were able to sync up and play from the same piece of sheet music (DNA). I don't remember exactly how I encoded the notes (If I recall the user was able to (1) select how many alleles should be in a note (2) the program would then break a given strand up according to the value entered (3) the user would choose the frequency to apply to ea
  • by peter303 (12292) on Thursday March 05 2009, @01:14PM (#27079105)
    Scientist implant DNA sequence downloaded by SETI. They didnt understand it, but it turns out to be BAD. Thats how the evil aliens propagate themselves.
    • by gravos (912628) on Thursday March 05 2009, @12:00AM (#27073663) Homepage
      I can't figure out why this project is so interesting. The audio sounds like weird computer-generated noise to me and the images look like colored noise with some weird patterns in them. Who cares? It looks like the data segment of a program when I dump it to video memory accidentally. Yeah there are patterns but what is the value in them? Not much.
      • Bring the 14.4 modem out of the closet and demodulate the audio sequence data.

        Then, when you've got the entire code backed up locally, sue them for releasing
        sensitive medical data over the internet without authorization.

        Step 4: profit.

        • It would be pretty awesome if they could write some software that takes the person's dna sequence as input, and outputs one of those composite picture of you made up of pictures of you things. But I guess some kind of fractal pattern is the best one could really hope for.