Breakthrough In Human Genetics

Many readers have submitted this story about a breakthrough in our understanding of human DNA: in particular, how much variation can exist between peoples' genes and how genes are involved with certain diseases. "One person's DNA code can be as much as 10 percent different from another's, researchers said on Wednesday in a finding that questions the idea that everyone on Earth is 99.9 percent identical genetically. They said their new version of the human genetic map, or 'book of life,' fills in many missing pages and chapters to explain how genes are involved in common diseases. The Human Genome Project mapped the billions of letters that make up the human genetic code. Scientists later refined the map by looking for single variations called SNPs or single nucleotide polymorphisms. The CNV map gives researchers a different way to look for genes linked to diseases by identifying gains, losses, and alterations in the genome."

Spelling on Slashdot

[Harmonious Botch]

One person's genetic code can be 10% different from another's, and chimps are 98% the same as humans.
No wonder so many of you can't spell.

Re:Spelling on Slashdot

[gringer]

My guess is that they're referring to human specific variation, i.e. 10% of the DNA that varies within human populations, rather than variation in all DNA.

Re:

[bloobloo]

So you are saying that the DNA that varies in the human population is 10% of the DNA that varies in the human population?

Re:

[gringer]

Close. I'm suggesting that perhaps the DNA that varies between two people is 10% of the DNA that varies in the human population.

Re:

[TheABomb]

But for the chimpanzee-human adage to be correct, there would have to be less than 2 percent variation between any two humans. A difference of 10 percent of two percent, 0.2 percent, would still leave everyone at least 99.8 percent the same, and that's hardly newsworthy enough to make a story.

And if you RTFA, the project apparently only worked with 12 percent of the total DNA. That means that at least there's 1.2 percent difference to work with, unless the supposed 10 percent is actually 5/6 of that 12 pe

Re:

[bitt3n]

mad parrot opp!

Re:

[DarkReign]

Creationists on slashdot? I thought this place only had smart people.

On The Origin of Slashies...

[Anonymous Coward]

Creationists on slashdot? I thought this place only had smart people.

And where do you think these smart people came from? Unless you seriously believe that they spontaneously appeared on slashdot fully-formed, they must have evolved from something ;)

Re:On The Origin of Slashies...

[mrRay720]

>Unless you seriously believe that they spontaneously appeared on slashdot fully-formed, they must have evolved from something

My ancestors visited Digg? No, say it ain't so!!! It can't be, anyway, there are no itermediary fossils!

Re:

[theshowmecanuck]

I for one welcome our new ook ook ook ahem chimpanzee overlords.

How the code works

[cluckshot]

Well I know that the general opinion of the genetic code has been some sort of simple weight of the 4 letters of the code or some pure sequencing data. Well now for the geeks on Slashdot comes a decent translation.

The genetic code of a person is like a computer program that builds and runs a person. It is the firmware and OS if you will. Without getting too complicated the old method of comparing the code would have been like counting all the instructions in a assembly language program. Then by adding

Re:

[MightyMartian]

When Answers in Genesis can actually directly answer the fact that humans and other great apes share a vast number of retroviral insertions, then we can talk. Until then, they're just a pack of liars.

Re:

[Anonymous Coward]

Wow. That link took an interesting scientific report and then added a stupendous amount of stupidity. Here's the original source: http://www.pnas.org/cgi/content/abstract/172510699 v1 [pnas.org]
Here's why scientists believe two ape chromosome pairs fused into one human chromosome pair (which your link claims is ridiculous without any explanation): http://www.gate.net/~rwms/hum_ape_chrom.html [gate.net]

"The common ancestry scenario presents two predictions. Since the chromosomes were apparently joined end to end, and the ends of

Re:Actually

[John Newman]

It depends on what, exactly, you are comparing. If you pick out a human gene and its chimp counterpart, and line up the sequenes, you find they are about 99.8% identical at the nucleotide level (and often 100% identical when you look at the encoded amino acids). These regions are presumably under selective pressure. If you do the same for corresponding non-gene sequences, ones which are not under selective pressure, you find they are 98.6% identical. However, now that the two genomes are essentially complete, we know that there are some large-scale duplication and deletion events, as well as variations in mobile elements, that make the overall identity between the two genomes somewhat less than the 98-99% identity between homolgous sequenes. So 95%, 98.6%, or 99.8% - all are correct answers in the correct context.

(IIABioinformaticist)

Re:Actually

[timeOday]

So 95%, 98.6%, or 99.8% - all are correct answers in the correct context.

...and all irrelevant anyways, as to the issue of how different the phenotypes of chimps and humans are. Heck, the human brain is 70% water, does that mean the head is "pretty much" like a 1/3 empty coffee pot? With changes to far less than 0.2% of his DNA, Einstein could have gone from genius to a miscarriage that his mother never even noticed. It's great for medical experimentation that chimps are so similar to people, but gene sequencing doesn't suddenly make us any more or less similar than we were before.

Re:Actually

[mrRay720]

Very true.

Whenever I hear people talk about how we're "99% like a chimp", "45% like a fern", "76% like a catfish", etc. I just point out that we are not DNA. DNA is just the intruction manual on how to make us.

A more accurate analogy would be that the user manuals for a chimp and a human are 99% similar. Considering that the first 950,000 of 1,000,000 pages are about basic body structure, chemicals, etc, that's hardly surprising.

Re:

[polar red]

Heck, the human brain is 70% water, does that mean the head is "pretty much" like a 1/3 empty coffee pot?

I would argue that for many people 70% of the brain is air.

Re:

[Tim C]

How ironic, given your sig.

Re:Actually

[superyooser]

Another article [independent.co.uk] covering this discovery puts the difference at 96%.

Another implication of the finding is that we are more different to our closest living relative, the chimpanzee, than previously assumed from earlier studies. Instead of being 99 per cent similar, we are more likely to be about 96 per cent similar.

Re:Actually

[nacturation]

So how is parent Offtopic?

Because it's a creationist site whose tagline is "Upholding the authority of the bible from the very first verse." While the source generally shouldn't be taken into consideration when considering the argument, in this case it's similar to asking the KKK for informed research on black people.
 

Re:

[fyngyrz]

Because it's a creationist site

You can't expect them not to respond to something like this. The window in which superstitious fantasies like creationism exist just closed a little further; the fact of the myriad variations among humans and animals leans ever nearer to a mundane explanation, and further from the hand-waving vagaries of "soul" and "mystery."

The more information science puts on the table, the louder the screams from the superstitious will be. Right up until the day the last one lays d

Re:

[matw8]

exxon-mobile

They make those petrol powered cell phones right??

Natural Selection no longer applies to humans

[DeadCatX2]

Humans have escaped the phenomenon of Natural Selection, for the most part.

All of us who wear glasses? We should have been culled. All these people developing diabetes from eating too much sugar? Selected against. Asthma? You get the picture.

Running with the idea that there is a higher power that created the world, I would say that Natural Selection is the method that higher power uses to figure out what works. But now with health care and a strong sense of altruism, errors in the genetic code are propagating throughout our species and wrecking havoc. In other words, we're playing god by saving lives that should have been selected against and allowing them to pass on their flawed genes.

I also contend that if we were created by a higher power, and that higher power enabled us with the ability to modify our genetic code, then it is our right (nay, our duty) to do so; otherwise, we would lack this ability. I believe that we should selectively erase genes which cause a predisposition to things like Down Syndrome or diabetes or cancer, etc. This would effectively select against all detrimental mutations.

This could also be the limit of Natural Selection as it tends toward infinitely fast; beneficial mutations in one human (for instance, the HIV resistance that elite supressors have) could be propagated throughout the species' genetic code in a single generation.

Perhaps I should leave you with an example, one that even a Christian might be able to tolerate. Imagine a future where you and your s/o collect your eggs and screen them for genetic defects, like Down Syndrome. Once a viable egg has been found (and you don't have to look up what the hair color or eye color will be, you could just leave that to fate), start screening some sperm. Produce a viable fetus which will grow up to be healthy.

Now imagine that you were one of those people who didn't do that for your kid. And now your kid is born with a gene that means they're 80% likely to die from some horrible disease by the age of 30. If I were that kid, I would be pissed at my parents for not choosing the screening option.

Re:Natural Selection no longer applies to humans

[kripkenstein]

Humans have escaped the phenomenon of Natural Selection, for the most part.
All of us who wear glasses? We should have been culled. [etc.]

I disagree. Yes, the simple "the organism dies because of some trait, so there are less offspring with that trait in the next generation" is somewhat true today, as you say. But natural selection extends to much more than that.

For starters, sexual selection. Nowadays people have LOTS of choice in selecting a partner; it is very common to have many partners and even children with multiple partners. In addition, the number of children that people have is very variable - more and more elect to have none, while some people have quite a lot. All of this allows a few 'sexually preferred' individuals to contribute to the next generation's gene pool in a significant way, first in that certain individuals have more opportunity to have children - say, because of attractiveness - and second, that the number of kids is a personal choice that varies greatly.

Now, you talk about wearing glasses, diabetes, etc. - these are 'objective' issues that should be selected against, supposedly: "in the wild, such people would never survive". But the fact that we live in a different environment doesn't mean that OTHER selection pressures, perhaps just as strong, don't exist. They are just different.

Re:Natural Selection no longer applies to humans

[oliverthered]

Unfortunatally it seems to be just the kind of humans you wouldn't want running around the place that are having lots of children nowadays.

Re:Natural Selection no longer applies to humans

[gstoddart]

All of this allows a few 'sexually preferred' individuals to contribute to the next generation's gene pool in a significant way, first in that certain individuals have more opportunity to have children - say, because of attractiveness - and second, that the number of kids is a personal choice that varies greatly.

Well, anecdotally, I have observed that a lot of stupid and ugly people are having children. I don't meant his flippantly, I mean it literally.

I think the grand-parent has a very good point -- the people who are producing children are not being selected based on attractiveness, or ability to earn an income, or any form of "breeding of the fittest", they are being selected on their willingness to put out. I know in my high school, the biggest idiots were the ones having children. Repeatedly usually. Sometimes, they were helping to perpetuate a cycle of poverty of kids being born to poor, uneducated people, and having very few opportunities in life.

Modern society insulates people from any of the good parts of natural selection. Between welfare footing the bill for the kid, or irresponsible people who go around serially knocking up everyone they come across (no pun intended ;-), I see a lot of evidence that the least suitable are the ones contributing to the gene pool. Conversely, a lot of the intelligent/educated/productive people are choosing to have fewer or no kids.

I would argue that your point of "sexually preferred" people is more like "sexually available" -- they're not the most attractive or desireable people, they are whoever is handy. There's just way too many people peeing in the gene pool.

Cheers

Re:Natural Selection no longer applies to humans

[Burnhard]

Humans have escaped the phenomenon of Natural Selection, for the most part. All of us who wear glasses? We should have been culled. All these people developing diabetes from eating too much sugar? Selected against. Asthma? You get the picture. Running with the idea that there is a higher power that created the world, I would say that Natural Selection is the method that higher power uses to figure out what works. But now with health care and a strong sense of altruism, errors in the genetic code are propagating throughout our species and wrecking havoc. In other words, we're playing god by saving lives that should have been selected against and allowing them to pass on their flawed genes.

Sorry if my first post here is highly naïve, but you are making the assumption that caring for the sick or less fortunate is not itself a trait that has been selected for in previous generations. You mention a strong sense of altruism. This trait remains in the population because it is selected for, especially as Human (and primate) populations survive as groups, not as individuals.

Re:Natural Selection no longer applies to humans

[Jekler]

Humans have escaped the phenomenon of Natural Selection, for the most part. All of us who wear glasses? We should have been culled. All these people developing diabetes from eating too much sugar? Selected against. Asthma? You get the picture.

Your assertion presupposes that those genetic traits are actually inferior and not suitable for continued survival, which is unknowable until evolution has a chance to ferret them out. Poor eyesight could very well be an evolutionary advantage. Many predators have notoriously poor eyesight (for example monitor lizards and cats), but can hear/smell/taste far better which makes them great hunters and excellent candidates for evolutionary survival.

Diabetes? Type 2 diabetes can often go untreated (medically) managed solely by exercise and diet. The abundance of society's processed foods which contain obscene amounts of sugar is the biggest enemy of type 2. So you have a genetic class of people that need to exercise more and eat healthier.

I'm not saying that every disease is actually an advantage, but it's presumptuous of us to believe, from our limited temporal footprint in the history of evolution, that we can tell the difference between an evolutionary advantage and a weakness that should be culled. It frequently takes many thousands of years for natural selection to determine a victor in terms of evolution, and often times species we would consider inferior have prevailed over seemingly superior creatures.

At this point in time, things we might consciously decide to cull from the gene pool with genetic modification may actually be against our own interests. One person says "We fixed his eyes", another person says "But you broke his ears".

I disagree, there is still 'natural' selection

[Iloinen Lohikrme]

If we think that natural selection just means survival of the strongest or fittest, then the humankind should have died a long a go. For almost its entire history humankind has been dinner in dishes of predators. If you put a human and a lion one against another, the lion wins. The key in success of man has been group work, working together to achieve common goals: hunting, defending against predators etc.. In this backdrop having a bad eyesight or asthma doesn't matter so much, individuals with these negat

Re:Natural Selection no longer applies to humans

[Almost-Retired]

And now your kid is born with a gene that means they're 80% likely to die from some horrible disease by the age of 30. If I were that kid, I would be pissed at my parents for not choosing the screening option.

Sorry, I can't agree with that last statement, having been a step-parent to 2 of "Jerry's" kids for 17 years. Regardless of the physical problems and the fact that one has already died at age 34 of MMD, they were, and are glad to be alive. So don't try to put words in a hypothetical childs mouth, thats not what comes out when they make their wishes known.

--
Cheers, Gene

Re:

[Spazntwich]

Insightful? Garbage.

You ignored all of the aspects of his hypothetical, the key one being If you had the power to choose to produce a guaranteed healthy child and chose not to.

Your "rebuttal" is irrelevant, as the children to whom you refer weren't produced by a parent with the power to have otherwise guaranteed their health.

Re:

[Anonymous Brave Guy]

All of us who wear glasses? We should have been culled. All these people developing diabetes from eating too much sugar? Selected against. Asthma? You get the picture.

Sure I do, but your picture is a very narrow view of the idea of natural selection.

Consider that humans are the dominant species on the planet today for essentially two reasons: we form communities, and we develop tools to overcome our weaknesses. Neither of these has anything in particular to do with any individual's physical strengths

Re:

[Ithika]

You're missing the point. He's not saying that the species is worse off for having physically flawed individuals. He's simply pointing out that the human race is no longer improving through natural selection.

The human race - and this goes for all other species - was never "improving" since evolution is not a directed process. It merely changes. Take your teleological reasoning and wheesht.

As a specimen, ignoring our education and technology, are the humans of today any better off than we were ten

Re:

[bogado]

Humans have escaped the phenomenon of Natural Selection, for the most part. ...

Glasses, insulin and much of the modern medicine is a novelty that has only been available for more less a century. During the other hundred thousands years that humans were around they were being selected by diseases much like may of the other animals.

And the fact that we do have cure for several types of illness and diseases this does not mean that we are immune to natural selection. Natural selection does act, even if the subject is not killed. A person that get sterile for some reason is being selected

Unnatural Selection

[Comboman]

Perhaps I should leave you with an example, one that even a Christian might be able to tolerate. Imagine a future where you and your s/o collect your eggs and screen them for genetic defects, like Down Syndrome. Once a viable egg has been found (and you don't have to look up what the hair color or eye color will be, you could just leave that to fate), start screening some sperm. Produce a viable fetus which will grow up to be healthy.

Now imagine that you were one of those people who didn't do that for you

Good Science meet bad math

[DrKyle]

Looking at the writeup from Nature [nature.com]. They clearly state that these results point to maybe a 0.5% difference among individuals, or 99.5% identical. That's 20X less variation than this crap article would have you believe. The actual research deals with CNV's = copy number variants. So for a given stretch of DNA, different people in a population might have that region duplicated or triplicated which does not really allow them to make anything different, but it might alter the levels of expression of those genes. As this DNA is found in multiple copies it had largely been believed to have a low number of genes, as is the case of most highly repeated DNA, but the researchers have evidence that these repeated domains do contain a large number of unique genes. In a short summary/analogy:
Some people are 8 feet tall.
Some people are 4 feet tall.
Therefore, people vary in height by 200%.

It's obvious to see the failed logic in that case, that's the same thing here, just because 10% might potentially be variable, that doesn't mean any single person even exists at each extreme.

Re:Good Science meet bad math

[Bamafan77]

Looking at the writeup from Nature. They clearly state that these results point to maybe a 0.5% difference among individuals, or 99.5% identical. That's 20X less variation than this crap article would have you believe.

Well, to be fair, the Reuters article states that "One person's DNA code can be as much as 10 percent different from another's", not IS 10% different. That seems to cast the statement in the light of "theorhetical upper limit", rather than "absolute truth".

Re:

[RuBLed]

no one then can be more than 10% uglier or more than 10%!uglier than me. phew!

Re:Good Science meet REALLY bad math

[Boghog]

OK, according to the Chromosome FAQs:
http://www.ornl.gov/sci/techresources/Human_Genome /posters/chromosome/faqs.shtml [ornl.gov]
The X chromosome comprises ~5% of the genome while the Y chromosome is ~1%. Since women are XX and men are XY, men and women differ by ~6%.
If chimps are only 2% different from men, then men are more closely related to chimps than women. QED

Re:

[AltGrendel]

I think your problem is that you are comparing the percentage difference in one gene (XX vs XY), then take the percentage difference of two whole genomes (Human vs Chimp)and presuming that the differences scale accurately. Someone should call the Analogy Police on this.

Re:

[Artifakt]

I'm starting to take that seriously, although technically, you mean men are more closely related to male chimps than to women.

From your numbers, male humans have about 1% of their genes that simply do not exist in female humans. If some genes truely code for behavioral modifiers, then there is a very good chance some of those are found on the Y chromosome. Women can't have those genes, by definition. Ergo, the conclusion should be: If genes sometimes code for behavior, men have a wider range of possible beh

Re:

[Rakishi]

Well first of all in women one of the X chromosomes shuts down so at a gene level man and women have the same number of usable X chromosomes. Furthermore the Y is only .38% of the genome AND has a very low number of genes (even for it's size). Also chimps can be both male and female, the 2% comparison is probably using a full genome (X + Y + rest) so comparing a human male to a female chimp would have a larger margin.

The race question.

[elucido]

If there is this much variation between two individuals, does this finally disprove the whole "race" myth once and for all? Appearance only accounts for at most 15% of a persons genes. Since there are no "race specific" genes, and the science is basically saying that there is massive difference between two individuals, when will the religious ideology catch up to the science?

When are we going to classify people according to their genetic quality/type and not their appearance?

Race and genetics

[Dobeln]

From the article in the Independent referenced elsewhere in this thread:

http://news.independent.co.uk/world/science_techno logy/article2007490.ece [independent.co.uk]

"The scientists looked at people from three broad racial groups - African, Asian and European. Although there was an underlying similarity in terms of how common it was for genes to be copied, there were enough racial differences to assign every person bar one to their correct ethnic origin. This might help forensic scientists wishing to know more about the race o

Race and genetics cont.

[Dobeln]

"The only strange thing I see in your post is that people of mixed ancestors aren't cited. So I guess in your world people don't mix at all and can be precisely determined what they are."

No, but it can be determined very accurately if people have recent (broadly speaking) ancestry in a particular part of the world.

"Do you live in Nazi Germany, 1940?"

Ah, the Hitler thing. How original.

"If they do mix, how "the research" identifies them?"

Using non-binary designations, probably. It's like colors - there is no discrete line where one color becomes another, yet people rarely go around proclaiming that "colors do not exist". Racial designations is a matter of utility and economy of information.

When it comes to "tagging" however, the old racial classificiations remain remarkably efficient - I.e. if you compare how people self-identify with their genetic makeup, a computer will usually sort them into their own self-classified category with a high degree of precision. Certain fashionable ethnic identifiers are far less effective than racial ones, however, I.e. "hispanic".

"My guess is that a lot of people in here or in science have a bias towards a racially segregated society, where people don't mix, just like the US and european countries."

Ah yes, scientists are all racists - that must be it. Interestingly, this kind of exchange is rather typical, I.e:

Scientists: "We have lots of new cool genetic data!"

Lewontinites: "Hitler! Racism! Hitler! Racism!"

etc. etc.

Re:Race and genetics cont. pt. II

[Dobeln]

1. I am not an american and do not live in the US.

2. "That means absolutely nothing. How much recent is?"

Did you read the article I linked regarding the Hapmap? You can very accurately pinpoint ancestry by looking at a person's genome. This will, as the article points out, help forensic science, etc. a great deal.

3. "Without precise definitions and evidence backing it all, this "idea" is nothing more than wishful-thinking."

Again, did you read the article I linked regarding the subject of this entire post? I

Re:

[Dobeln]

First, it's good to see people reading GNXP - I blog there occationally ;)

Couple of points though:

1: Brazil is a far more "mixed" country than the United States - I.e. there is more of a color continuum than in the US.

2: Hence, self-identified race is a less useful concept in Brazil than in the states, and a much less useful concept than when comparing, say, nigerians with icelanders. (Especially as many visible racial markers have started to mix around seriously in the population)

3: Still, as the diagram i

Re:

[andersa]

Now that you mention it, that's wrong too. Because you should use the midpoint between the two extremes as reference point. Then the difference is only 2 feet which is 33% of the 6 feet you took as midpoint.

chimpanzees=98% human

[circletimessquare]

i remember reading that humans and chimps are 98% the same

and previous to this announcement, all people were 99.9% the same

the implication here is that people are actually as low as 99% the same

which means one crazy ass inference:

it should be possible to find two people and a chimp such that and person A is equally different from the chimpanzee as he is from the person B

no way

Re:

[B3ryllium]

They're called Slashdot posters.

Re:chimpanzees=98% human

[RetroRichie]

We already found him. And we elected him President!

Re:chimpanzees=98% human

[Anonymous Coward]

> And we elected him President!
Elected?

Re:

[qewl]

Reminds me of the old bumper sticker- "Bush is a Punk-Ass Chump" That I always misread (or perhaps more accurately) as "Bush is a Punk-Ass Chimp"

Re:

[cheesygrapes]

Okay let's think about this logically: If 99% of human DNA is the same then that means any two humans are going to have at least 99% in common (because that is the 99% that is the same in all humans) chimps have 98% which doesn't mean that there are two people such that one is equally different than the person so yes, if you throw logic to the wind and pull stuff out of your ass(pretty common on slashdot it seems), you can make crazy inferences

Re:

[eraserewind]

Well, not necessarily. You are assuming that the 99% people are closer to chimps, but they could well just be farther or equidistant from chimps. It depends on where the variation is.

Re:

[Damek]

chimpanzees=98% "human"

define "human" [bookswelike.net]

Misunderstanding

[Anonymous Coward]

No, no, no, no, no... this is all just a misunderstanding of scientifical facts. You see, it's only the darker folks, whom we are 10% different from, that are 2% different from monkeys. The world was made this way intentionally, presumably by some Great, Omnipotent Designer... whatever you want to call him. I know this to be true because I learned it in a museum. In Kentucky. It was right next to the exhibit with humans and dinosaurs living together.

Honestly folks, get it together already.

How does this impact genetic therapies?

[Salvance]

If there is so much variation between humans, how does this impact future genetic therapies? Wouldn't we need to map each person's genome, then study the impact of disease on each of the genes, to understand what gene therapies would work best for an individual? This article seems to suggest that the everyday "We've found the gene that causes " claims are only true for a subset of the population.

Re:

[tempest69]

umm how to start.. The guts of the matter are that having more genetic information about someone is usually usefull. The more we discover the more we can determine the effacacy of different medications.. if someone is missing a receptor for morphine then it's just going to give them constipation.

The CNV variations wouldnt show that something is missing, but it might help with dosing requirements. If there are more copies of a blood clotting factor in a person who has just survived a mild stroke, the

Um... not quite.

[Punchcardz]

"One person's DNA code can be as much as 10 percent different from another's, researchers said on Wednesday in a finding that questions the idea that everyone on Earth is 99.9 percent identical genetically." It doesn't call it into question at all. The simple matter is that how you define "different" and measure the percentages makes a big difference. The human genome is ~3 billion base pairs. You can have a singe nucleotide change in a gene of say 5000 base pairs. When you compare a given gene between individuals, do you count the whole gene as being entirely different? Or do you say that it is 99.98% (4999/5000) the same?

Gene Expression?

[foobsr]

It is always interesting to see how they ignore gene expression, the role of the extracellular matrix (where much of it happens), the importance of mechanotransduction (tensegrity, see Ingber) and thus posture (as a way to cope with gravity as a constant stimulus) when it comes to causes for deseases.

Well, salesdroids of the pharmaceutical industry, IMHO.

CC.

Re:Gene Expression? WTF?

[fleshball]

Dude, I have no idea what you are bitching about. 1. Gene expression is one of the most active areas of research, pharmacagenomics is actively being researched. Have you even heard of Gleevec? Cures people with a specific mutation? 2. It is WAY easier/cheaper/more standard to measure gene expression than to sequence them. 3. How tensegrity plays into signal transduction / gene expression is still unknown. 4. The ECM is an active area of research and drug targets for cancerand clotting. ....And if you s

God vs Man

[eebra82]

Does anyone know what stance our major religions have on DNA? For example, how should a true Christian receive this news?

I know it's not entirely on topic, but seeing that the bible describes humans as flesh and blood and as one, it would be interesting to see what this up-to-ten-percent-difference would put science against religious belief.

Re:God vs Man

[timmarhy]

picture someone sticking they hands over their ears and yelling LALALALALA I CANT HEAR YOU, and you will know the religous stance

Re:God vs Man

[A beautiful mind]

There are even scarier truths in science. Imagine this:

100% of the atoms making us up are DIFFERENT. No two person has the exact SAME atoms!!

Oh please say it ain't true! Say it ain't true! Now I will have to meditate for half an hour in my religious beliefs just to be able to breath again!

Re:

[Anonymous Brave Guy]

Say it ain't true! Now I will have to meditate for half an hour in my religious beliefs just to be able to breath again!

Watch carefully now, children. We're about to see a fine example of natural selection at work...

Re:

[iknowcss]

The Christian tinge in my background doesn't seem to object to the notion of DNA. How exactly is it contradicting the bible?

Re:

[mgblst]

Not being Christian, there might just be a chance that he hasn't read the Bible.

It seems to a lot of people that when you are talking to a Christian, you have no idea what they believe, since they seem to cherry pick what scientific evidence they are willing to accept. So you neve have any idea how to talk or argue to them. The problem has existed for 100 of years, since before Galileo.

Re:

[eraserewind]

They should receive it the same way as everyone else unless they are idolaters of the written word :P

Re:

[vhogemann]

Well,

Actually Christianity is a general term for the group of people that follow Jesus. There are several Christian religions, you just can't put all of them in the same pack! Maybe in the USA there's only the Catholics and the Protestants... but even among these two there is a lot of difference on their beliefs.

And elsewhere in the world there's even more Christian religions! For example, here at Brazil we have Umbanda[1] and Candomblé[2], two Christian religions that mix the Catholic and African trad

Re:

[bazorg]

For example, how should a true Christian receive this news?

I'm not religious, but let me try: Adam was created by God using mud from a river bank. The materials available in common earth are not different from the ones found in a human body.

All the matter in the Universe was concentrated in one single place and time, then it exploded and eventually became all the stars, planets and creatures we know today. God is everywhere and we all are part of God.

Simple creatures evolve to become complex creatures. If

Re:

[Ginger Unicorn]

not that i'm at all religious, but you really are grasping at straws. i'm sure this news has absolutely no implication on what the bible says whatsoever.

"the bible describes humans as flesh and blood and as one"

What, are you implying that christians believe humanity is one giant homogenous blob of flesh? Or that we are all clones? We illusions of theirs does this 10% threaten to shatter?

Re:

[CmdrGravy]

"perhaps one day we can find new evidence that will reconcile both theories"

In fact we already have, it's been discovered that the bible is just some book written around 1700 years ago and has absolutely nothing to say about the origin of life, or any other scientific matters. As such it contains no theories and you can now discard it as anything but a fanciful fairytale.

Bible is not 1700 years old, per se

[pbhj]

OK. If you take that the Bible is a compendium, or codex, of books then the Bible as we know it is about 1800 years old. However some of the books, I only know about Isaiah were written substantially before Christs life. Isaiah is believed by Christians / Jews to contain many prophecies about Jesus / The Messiah and was written IIRC about 500 years BC.

Informative?

Cheers.

PS: http://en.wikipedia.org/wiki/Dating_the_Bible [wikipedia.org] gives an estimate of 1500 years BC for the Pentateuch (first 5 books of Old Testament).

Re:

[CmdrGravy]

I realise that however if you are looking for any scientific theories to reconcile with actual science I had assumed you could rule out the entire old testament straight away.

Re:God vs Man .. who are you talking to

[pbhj]

>> ... anyone here ... ?

I don't know why your asking there's only you here.

At Last

[umbrellasd]

My brother is explained...

Re:

[onion2k]

Jeb Bush, is that you?

oblig Steven Wright

[opencity]

"Everyone on the earth is unique,
except this one guy ..."

Differences between people

[Bob54321]

That 10% is way off. There is on average a variable base (across all people) every 300 bases. So by my calculations, people are at least 1 - 1/300 = 99.7% similar. Not everyone can be different everywhere so that gets us back in the 99.9% territory. The copy number variation map has not changed those numbers that much...

more examples of fuzzy math

[circletimessquare]

1 million monkeys randomly typing typewriters = 1 shakespeare manuscript created

monkeys and humans 98% the same, and this new genetic analysis indicates human up to 10% different, or, only 90% the same

therefore, 98%-90% = 8% difference in monkey versus human random shakespeare manuscript creation

8% of 1 million is 8,000

therefore, 8,000 more monkeys than humans are required to produce one shakespeare manuscript

it's a scientific fact folks

(as well as all other "facts" gleaned from this 10% number in the article)

Actually,it's better than that

[Colin Smith]

A trillion atoms bouncing around, randomly stuck together, formed a humanoid being and actually did write the complete works of Shakespeare! If that isn't evidence of Intelligent Design I don't know what is.

 

Concrete applications of fuzzy math

[WormholeFiend]

1 million geeks typing and mouse-clicking not-so-randomly = slashdot effect

I doubt you could herd a bunch of monkeys together and do the same, unless Slashdot started posting articles about bananas

Re:

[varghan]

I object to the statement

1 million monkeys randomly typing typewriters = 1 shakespeare manuscript created

My keyboard has 103 keys. Placing a 1e6 monkeys behind 1e6 of these computer would generate a 1/103 = 0.009 chance for hitting the exact right key. The chance of generating for example Titus Andronicus (140.187 characters, including spaces) is therefore (1/103)^140187. Nearly infinite I would say. Even generating Sonnet XVIII, Shall I compare thee to a summer's day (614 characters including spaces) would need 103^614 monkeys, again infinite. One million monkeys, using 1e6 computers

Pedant reporting for duty

[Firehed]

Billions of letters? Billions of nucleotides, sure, but they're represented by four different letters last I checked.

Re:

[nacturation]

Easy solution... wc utility to the rescue, and have it report on the number of characters.

wc -m mydna

Does it return a huge number, or 4?
 

10% variation

[goldcd]

doesn't mean anything unless it's 10% of the genome that's actually expressed, or if it is creates a functionally different protein. Working on the assumption that we do actually evolve, then we'd need to have sections of DNA that can alter without having an immediate effect - like a scribble pad where stuff could just be doodled.

Genes probably don't matter so much

[mveloso]

Even if two genomes are 100% the same, that doesn't mean that the products of each will be the same.

Why? Gene expression can differ depending on environmental factors.

As a simple analogy, your DNA = a cookbook. While many recipies are cooked automatically by the systems in your body, other recipies are cooked or not cooked depending on the environment in which the organism finds itself.

I haven't read a good article on gene expression, really. Various mechanisms are alluded to in the literature, but it seems to be unclear how gene expression is or is not triggered. More specifically, researchers seem to know that this particular mechanism turns a given gene on or off, but how that mechanism is triggered is unknown (or not the focus of the article/research).

Also, I'd guess that environmental gene expression stars in the womb - that the fetus gets clues to the external environment from the nutrients and chemicals coming from the mother and adjusts itself accordingly. You could test that by somehow getting ahold of some in-vitro twins and implanting them at different times, I guess? But there probably still would be too many variables.

Re:Genes probably don't matter so much

[KokorHekkus]

Also, I'd guess that environmental gene expression stars in the womb - that the fetus gets clues to the external environment from the nutrients and chemicals coming from the mother and adjusts itself accordingly. You could test that by somehow getting ahold of some in-vitro twins and implanting them at different times, I guess? But there probably still would be too many variables.

There was a very interesting BBC documentary "The Ghost In Your Genes" (http://www.bbc.co.uk/sn/tvradio/programmes/horizo n/ghostgenes.shtml [bbc.co.uk]) where they mentioned several interesting results about environmental effects on gene expression. In the program (and linked BBC article) one researcher mentions that he could turn some gene expression on and off in mice embryos by physically manipulating the embryos.

One very interesting thing they also talked about was the possible transgenerational effects by famine as an example of how environments affects the human organism. Överkalix in far northern Sweden was very isolated so there were struck by famine several times. Being Swedes they were also kept very good records of births, deaths etc. A researcher decided to look at the health of those families over 3 generations. I'd say they found something quite astounding: there was a link in grandmothers food supply and their granddaugters mortality rate, same for grandfathers and their grandsons (the link was either all on the male line or all on the female line).

For those who wish to read a little more about the transgenerational the researchers has written an (non-scholar) article at the University of Bristols website http://www.bris.ac.uk/news/2005/866 [bris.ac.uk]. I think there will a lot of really interesting developments in the gene expression research in the coming years.

Re:

[TheMeuge]

"I haven't read a good article on gene expression, really. Various mechanisms are alluded to in the literature, but it seems to be unclear how gene expression is or is not triggered. More specifically, researchers seem to know that this particular mechanism turns a given gene on or off, but how that mechanism is triggered is unknown (or not the focus of the article/research)."

I honestly don't know what it is you've been reading. Does the JAK/STAT system ring a bell..? the MAP Kinase cascade..? Or how about

Here's what I find interesting

[kilodelta]

If we're only 3% different from chimpanzees, then 10% between humans is significant. It would tend to indicate that evolution is at play, which is something I've long suspected. Evolution doesn't happen all at once, it starts with a positive trait and then over time spreads out among descendants.

Better Article

[BrickM]

http://news.independent.co.uk/world/science_techno logy/article2007490.ece [independent.co.uk]

This piece gets a few of the key facts correct where reuters went wrong, such as the already-mentioned "10% vs 10x" difference between individuals. It's a great read!

The secret...

[SIInudeity]

gtagcgtagatagctctagctagcttaggagcttagaggcgcttagatcg cgatcga

Re:

[Patrik_AKA_RedX]

*panic* He posted Antrax DNA! Evacutate the website! */panic*

Real world example

[Jugalator]

Example of a 10% different human [google.com].

So Logically..

[clickclickdrone]

If I can get some gene therepy to customise my already fairly unique, I'll have created something new and can thus patent myself? Cool! That will stop those pesky cloners.

"Race is just a social construct"

[Baldrson]

"Race is a social construct" -- well ok, it can be categorized via a laboratory test with 99.7% accuracy. And human biodiversity is simply a matter of a disappearingly small percentage of genes -- well ok maybe 10 times that amount and well, ok, ok, a significant fraction of the difference between humans and other great apes. And all of this "error" is biased toward the "genes don't matter" camp during the peak of boomer fertility when de facto polygyny (misnamed "serial monogamy" by the same academic auth

comparing apples with pears

[picob]

100% of these comparative studies are highly speculative. Take into account: 10% of the DNA codes for proteins (this DNA was sequenced in HUGO on which most comparative studies were based) 90% was named junk-DNA, but isn't really. It is now recognized that it is functional in the sense that it regulates the expression of other genes. This DNA can differ a lot more among individuals and species. The functions of 'junk'-DNA are only partially known, but it is clear that in addition to some proteins (express

Re:

[anvilmark]

No, I think it might be more like "yours has 4 cylinders and mine has 12". Or 4 wheels vs 10.

The changes they seeing produce functional differences - not cosmetic.

Re:

[Hognoxious]

Sadly, it would appear not: http://science.slashdot.org/comments.pl?sid=208050 &cid=16962092 [slashdot.org]