Human Genome Sequencing Completed

Arthur Dent '99 writes "According to this article at Reuters, the last chromosome in the human genome has finally been sequenced, taking 150 British and American scientists 10 years to complete. The sequenced chromosome, Chromosome 1, is the largest chromosome, with nearly twice as many genes as the average chromosome, making up eight percent of the human genetic code. The Human Genome Project has published the sequence online in the journal Nature, according to the article. It contains 3,141 genes (over 1,000 of them newly discovered), and 4,500 new SNPs -- single nucleotide polymorphisms -- which are the variations in human DNA that make people unique."

First Chromosome

[LiquidCoooled]

I won't bore you with the details, but theres lots of GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGC type things here [sacred-texts.com]

Re:First Chromosome

[PyrotekNX]

I always wondered where the movie GATTACA got it's title.

Re:First Chromosome

[tomhudson]

Well, now that they've sequenced the Genome, can sequencing the KeDE be far behind?

Re:First Chromosome

[Frogbert]

... Followed by Quagmire shouting "All Right" whilst thrusting his pelvis

Re:Stupid Question

[Anonymous Coward]

Half answer:

The beginning is very likely a non-coding region, since stuff near the ends can get damaged more readily. The chromosome itself probably does not exactly start with GAT, it probably has a few thousand bases worth of telomere, and this just happens the be the chunk that starts once they get past all that.

Everybody has different genes, but the difference between two indviduals over the total range is measured in decimal-points of a percent. Big chunks of it are exactly the same from person to pe

Re:Stupid Question

[mishmash]

One point is that there's very little variation between individuals in terms of coding sequence - in this chromosome from the article there's only just over 1 base where there are known single base changes per gene. The most common type of variation is in the number of times repeated streaches of DNA are repeated, this generally (though not always) has no effect on an individual. The numbers of such repeats in the draft sequence are not meaningful in the published sequence.

Databases of variation in the h [cgb.ki.se]

Re:First Chromosome

[trentblase]

Funny you should mention that, since acording to wikipedia:

"Each draft sequence has been checked at least four to five times to increase 'depth of coverage' or accuracy. About 47% of the draft were high-quality sequences. The final version will have been checked eight to nine times giving an error rate of 1 in 10,000 bases."

Which means that there will be an estimated 300,000 errors in the project.

So now.

[AltGrendel]

Can we start the patent countdown clock?

Re:So now.

[espressojim]

You can't patent seqeuence info. You haven't been able to since 2000. Get with the times.

Secret Project Complete

[FhnuZoag]

Now where's my +1 Talent in every base?

MOD PARENT UP!

[Silverlancer]

Alpha Centauri reference = complete win!

Re:Secret Project Complete

[Fjornir]

Please don't go. The Drones need you. They look up to you.

Would've been decoded sooner ...

[Anonymous Coward]

if God wouldn't have used LISP to encode the darn sequence in the first place

Re:Would've been decoded sooner ...

[Fjornir]

You thought wrong [infogroep.be].

I was taught assembler
in my second year of school.
It's kinda like construction work --
with a toothpick for a tool.
So when I made my senior year,
I threw my code away,
And learned the way to program
that I still prefer today.

Now, some folks on the Internet
put their faith in C++.
They swear that it's so powerful,
it's what God used for us.
And maybe it lets mortals dredge
their objects from the C.
But I think that explains
why only God can make a tree.

For God wrote in Lisp code
When he filled the leaves with green.
The fractal flowers and recursive roots:
The most lovely hack I've seen.
And when I ponder snowflakes,
never finding two the same,
I know God likes a language
with its own four-letter name.

Now, I've used a SUN under Unix,
so I've seen what C can hold.
I've surfed for Perls, found what Fortran's for,
Got that Java stuff down cold.
Though the chance that I'd write COBOL code
is a SNOBOL's chance in Hell.
And I basically hate hieroglyphs,
so I won't use APL.

Now, God must know all these languages,
and a few I haven't named.
But the Lord made sure, when each sparrow falls,
that its flesh will be reclaimed.
And the Lord could not count grains of sand
with a 32-bit word.
Who knows where we would go to
if Lisp weren't what he preferred?

And God wrote in Lisp code
Every creature great and small.
Don't search the disk drive for man.c,
When the listing's on the wall.
And when I watch the lightning burn
Unbelievers to a crisp,
I know God had six days to work,
So he wrote it all in Lisp.

Yes, God had a deadline.
So he wrote it all in Lisp.

All credit to Julia Ecklar -- and (I believe) Heather Alexander who is singing the linked copy.

I'd like fries with that

[gentimjs]

I'll take my next kid with larger-than-average height, enhanced frontal lobes, a natural resistance to the polio virus, OH and dont forget the 20/10 vision!

Re:I'd like fries with that

[MBCook]

Odd things can be related. I remember hearing about how there were fox fur breeders somewhere (like in Russia). They decided to try to breed tamer foxes so they wouldn't have to worry about getting bit so much. Well after a few generations they succeeded. There was only one problem: all the tame foxes had a big white streak down their back, ruining the pelt. They two traits were related somehow, even though you wouldn't think it.

So, what if it was a choice between good vision and very high intelligence? How about between good vision or very low risk of cancer/heart disease?

Bad vision is correctable. If there is a trade off to make, good vision would be something that wouldn't be too hard to trade for something better.

Re:I'd like fries with that

[0racle]

The above poster didn't indicate that the poor eyesight was a trade off, they specifically asked for it leading me to believe they are among the many idiots in the world that think 20/10 eyesight is better then perfect.

Re:I'd like fries with that

[CoughDropAddict]

Care to explain the difference? The "idiots" who wrote the Visual acuity [wikipedia.org] article on Wikipedia are apparently under the same misunderstanding:

It is possible to have vision superior to 20/20: the maximum acuity of the human eye without visual aids (such as binoculars) is generally thought to be around 20/10 (6/3).

Re:I'd like fries with that

[Daniel Dvorkin]

You're just wrong about this. 20/10 means you can resolve something 20 feet away twice as well as the average person; similarly, 20/40 means you can resolve something 20 feet away half as well as the average person. But 20/10 does not mean your eye is misshapen or your sense of perspective is off. It simply means you have better distance vision than average. Now, you may also be "farsighted" -- i.e., have trouble resolving things close up -- but the two are basically independent of each other.

20/20 isn't "perfect," BTW. Human vision is very good compared to that of most animals, but it's laughably bad compared to that of, e.g., birds of prey. I guarantee you an eagle can see better than you can whether it's spotting a rabbit from a few hundred feet in the air, or staring that same rabbit in the face right before dinnertime. ;)

Re:I'd like fries with that

[visgoth]

20/10 vision could result from simply having "clearer", more precisely shaped corneas and lenses in your eyes. In this case eye strain would be a non factor, as the muscles would not be overcompensating.

There's studies being done using adaptive optics to enhance human vision to far beyond even 20/10 accuracy. Here's a google search [google.ca] to get people started.

Re:I'd like fries with that

[Fred_A]

It is being passed much more slowly though. Everyone knows that people with 20/10 vision have less FPS.

Re:I'd like fries with that

[Citizen of Earth]

Everyone knows that people with 20/10 vision have less FPS.

Dogs actually have a higher FPS perception than we have. OTOH, they've been known to eat their own poop. There's an efficiency/complexity tradeoff in neural computation systems.

Re:I'd like fries with that

[k98sven]

They two traits were related somehow, even though you wouldn't think it.

Which is more of a typical example of Science challenging our preconceptions than actual "oddity".

To make an analogy, if you came across a switchboard with 100 light bulbs and 100 switches, you'd probably assume each switch turned on a light. Then you'd be confused to discover that some switches turned on two lights, some lights needed several switches to be on, and some switches did nothing at all.

Of course, if you looked under the hood and saw how the thing was wired, you'd then find that there wasn't actually anything strange going on, just that your assumption of how the thing worked was oversimplified.

I think this oversimplification is one of the reasons some people have trouble understanding evolution. It's a bit hard to understand how things like heireditary genetic diseases could exist if you assume that it's a completely independent property (and indeed, most of them probably wouldn't exist if it was).

Another fun example of non-obvious traits in humans is that a single SNP (prevalent in East Asians) causes you to sweat less, but also causes you to have dry and crumbly earwax instead of the gooey, sticky stuff most people have.

Re:I'd like fries with that

[khallow]

Odd things can be related. I remember hearing about how there were fox fur breeders somewhere (like in Russia). They decided to try to breed tamer foxes so they wouldn't have to worry about getting bit so much. Well after a few generations they succeeded. There was only one problem: all the tame foxes had a big white streak down their back, ruining the pelt. They two traits were related somehow, even though you wouldn't think it.

That doesn't mean that the traits will always stay linked. They probably res

Re:I'd like fries with that

[thisissilly]

More info here: http://en.wikipedia.org/wiki/Tame_Silver_Fox [wikipedia.org]

Re:I'd like fries with that

[MBCook]

I should have checked Wikipedia. Thanks for the link.

I keep forgetting just HOW MUCH STUFF Wikipedia has. They are quickly approaching Tower of Babble / Library of Alexandria status in many ways (at least in English).

I'd Like A Blonde With That

[umbrellasd]

So, what if it was a choice between good vision and very high intelligence? How about between good vision or very low risk of cancer/heart disease?

Because we can inexpensively correct vision, I'd say if this coupling existed, we would already be naturally selecting toward bad vision. More people will die from cancer/heart disease than from glasses. Pretty sure about that. Since we haven't turned into mole people, I think the two are probably pretty independent though.

But I am still wondering about t

The genome trading card game

[Opportunist]

I'd give smarts for insight any day.

Sometimes, I'd give intelligence for booze. Life'd be a lot easier and less painful.

Re:20/10 is better than perfect!!!

[zeno_2]

Just to add on to this

20/20 vision means that when you stand away from something at 20ft, what you see is what the normal person would see at 20ft.

20/40 is, well, if you stand 20ft away, you see what a normal person would see at 40ft

Same goes for 20/10.

Re:20/10 is better than perfect!!!

[The_Wilschon]

So... what can a normal person see at 20ft?

A simple question

[helioquake]

Why do one chromosone have more genes than others?

Re:A simple question

[WickedScorp]

They are all different sizes. Chromosomes are numbered from largest to smallest 1 - 22 (except 21 and 22; 21 is actually the shortest and 22 is slightly bigger; the mistake was made in early cytogenetics because they couldn't distinguish the sizes well enough and those two were named incorrectly) + X and or Y. So chr 1, being very large, has a very large number of genes just because it's huge. It isn't the most gene dense, however, which is chromosome 19 with more genes / Mb than elsewhere in the genome.

Re:A simple question

[pintpusher]

chromosome 19 with more genes / Mb than elsewhere

luckily, this [slashdot.org] amazing breakthrough will help you store chr19 in less space.

Re:A simple question

[SnowZero]

Evolution is a process with a lot of randomness. So I'd instead ask the question: Why would you exepct them to be the same?

don't confuse

[tacokill]

Don't confuse randomness with not knowing how it works. Perhaps it just LOOKS random because we don't see or understand the pattern/function yet?

It seems to me that there are definitely some "rules" for evolution, although our understanding of them and how they work is very very limited -- for now. I mean, we don't see trees evolving into dogs and vice versa. So clearly there are some constraints on what can and can not be done within evolution.

But it's a hard thing to study because we've only bee

Re:don't confuse

[It'sYerMam]

Evolution is inherently random, unless you're defining random as non-deterministic. Which nucleotide is botched in the replication process, or thumped by a cosmic ray is pretty random.

Re:A simple question

[FTL]

> Why do one chromosone have more genes than others?

Same reason some source code files contain more lines of code than others. They do different things.

Re:A simple question

[mapkinase]

Duh!

Re:A simple question

[cnettel]

That suggests some organization. It's more like why one patch in the sky contains more stars than another. Of course, there are some patterns, like the original Milky Way streak towards the center of the galaxy, but most of it is just a coincidence without any real "reason".

Another way to put it is that there has obviously not been enough of a disadvantage to have varying chromosome sizes, alternatively some slight advantage in maintaining something similar to the current layout. (Of course, significant ch

Re:A simple question

[Jasin Natael]

I also consider that one of the chromosomes could maintain (as a unit) the code for some very complex interaction that can't be further broken down. Maybe something to control the expression of genes, p2p communication (to correlate production of proteins, etc.), or even the definition of types for cell differentiation. Or a kind of file full of unique keys to keep the immune system from attacking the body's own cells (errors in which might result in allergies). Consider the size of concurrency control a

Because it evolved

[GrahamCox]

Why do one chromosone have more genes than others

Why not? It's because it wasn't designed by a computer geek (or anyone/thing else) where you might have said, hrmmm, we need about 30,000 genes for this design, so we'll split that into 26 chromosomes of 1,154 genes apiece. That should do it!

The fact is, we evolved, and so our components are just bits and pieces taken from all our previous ancestors, modified according to whatever was needed to suit the environment we happened to find ourselves in at the time. As with all natural, biological, dynamic processes, what emerges is often bizarrely disorganised, yet somehow works.

Re:Because it evolved

[GrahamCox]

Of course I meant 46 chromosomes...

Actually if it was designed by a computer geek, no doubt there would be 32,768 total genes and 32 chromosomes, with 1,024 genes per chromosome.

Comment removed

[account_deleted]

Comment removed based on user account deletion

Re:Because it evolved

[zenmojodaddy]

Maybe in Arkansas...

Re:Because it evolved

[fyngyrz]

Nonsense. We'd design it to have 32 bits to index the chromesomes, 32 bits to index the genes in each chromesome, and an alternate set of registers so you could quickly swap chromesomes for different tasks. You could clock it at any speed, or leave it static, and it'd never lose data. It'd be radiation hardened, low-power, erasable by ultraviolet, reprogramable by anything from dip switches to GHz pulse trains, internally and externally redundant, solar-powered, ecologically friendly, and involve a great deal of caffiene. Primary developmental needs would be met by carefully metered infusions of pizza.

However, because of technological limitations, only the bottom 4 bits of the gene index would actually be used, with the next 4 bits being set to zero by default, and the remaining 24 bits determining your average skin color.

Additionally, the 32 bit chromesome index would use 8 bits starting at the MSB, the next 8 bits would be reserved and set to zero, and the remaining 16 bits would be undefined, though later we'd find variations there gave rise to both creationist tendencies and division by zero, leading us towards a new design that is only 16 bits, but ran twice as fast and never divided by zero, or made up answers to questions without having known good data on the input side.

All other features would be put off for the beta version, because we'd have a little trouble with the alpha we didn't exactly anticipate.

Unfortunately, all advances gained by this leap in technology would be lost when hardware manufacturers forced new "quantum confusion" technology upon the geeks in a selfish race for more market share. Geeks fail to notice because they're too busy trying to get Genes 0.1 alpha through ANSI committee approval.

For maximum efficiency, this awesomely fast new technology requires light pipes for communications, however, in a legislative feat worthy of Maltheus himself, congress declares that production of light pipes within the boundaries of any state for use within the boundaries of that state represent interstate commerce of light paraphanalia, and so no one's going to be doing that, thank you. It's all part of the War on Bits. InSmell, primary manufacturer of light pipes in the USA, shuts all production down, fires half its workforce, and its stock goes up by a factor of four.

At this point, the only light-pipe architecture you can find comes from Japan, and the upper 24 bits of the gene index are all hard-coded to DDDDBB. It is expensive, but everyone buys it anyway. You can only run this hardware in Denmark. Floating (actually, more like drifting) point is emphasized, and virtual reality is experienced by all users, though that is not to say that it is the same virtual reality across the board.

In the meantime, US geeks invent open-source web 9.0, expend all their energy producing applications for it that have absolutely no merit whatsoever of any kind using the justly famous "Corundum on Wagon Ruts" technology to replace perfectly good desktop apps that already exist, but are really really cool because they can make almost any browser's "Joe" scripting language use all the memory in your computer... subsequently, geeks quietly go extinct while arguing if GPL or PD is the way to go for the open source path.

That's not a simple question

[SloppyElvis]

It may seem logical to respond that evolution yields varied results, or throw up hypotheses about the physics involved or whatever the hell you want. But these do not explain cause, and cannot answer why chromosomal size is varied.

So, if you really want to know, the answer is...

because.

Re:A simple question

[natrius]

In addition to what the other posters said, the chromosomes are numbered by their size up chromosome 22, then the 23rd pair is the X and/or Y chromosomes. Since this is chromosome 1 we're talking about, it's the largest one.

In a slow elderly Eastern European accent....

[GoofyBoy]

"To map the very stuff of life; to look into the genetic mirror and watch a million generations march past. That, friends, is both our curse and our proudest achievement. For it is in reaching to our beginnings that we begin to learn who we truly are."
      -- Academician Prokhor Zakharov,
      "Address to the Faculty"

Re:In a slow elderly Eastern European accent....

[Jerf]

Why do you insist that the human genetic code is "sacred" or "taboo"? It is a chemical process and nothing more. For that matter -we- are chemical processes and nothing more. If you deny yourself a useful tool simply because it reminds you uncomfortably of your mortality, you have uselessly and pointlessly crippled yourself. - Chairman Sheng-ji Yang, "Looking God in the Eye"

Complete list of quotes here [generationterrorists.com], although for full effect you really need to hear some of them. The voice acting on Alpha Centauri is amon

Oblig.

[mk_is_here]

Scientists: All your base pair are belong to us!

Remember kids...

[TheOldSchooler]

Your single nucleotide polymorphisms are unique! Just like everyone else's.

Part of the sequence:

[GroeFaZ]

ACGATCGTACGcopyrightTAGATCGCGTAGTAGCTAGCTGTbyGGCGG CGGTACGGCTATiehovaAGTCGATCGATGATCG5billionBC-TAGCT AGCTAGCTAGCTAGinfinityTAGTAGTATTTATTTunauthorizedA GGCGGTATGCTAGCTAGreproductionCTGATGTGTAGCCCAprohib itedCCAGCTTAGCTAbyGCTAGCTAGTGTAAATCGCCATCGCGCCTAdi vineTTCTCTAGAGCTTAGCATGCTAlawCGTACGTAGCTA

Re:Part of the sequence:

[KarmaOverDogma]

Dear sir(s)

You have posted parts of our patented human genome sequence without our prior authorization. We demand that you cease and decist this post and remove it immediatelty, or you will be hearing from our lawyers in short order.

Sincerely,

Genectics Mega Corp.

Re:Part of the sequence:

[ggvaidya]

ACTTTTTCGCGAGAGGAGAGTGAGT//todo:this should only return a positive values!AAAAAATTTCTATCTACTATCTACATATCATTACA/*warnin g we are kluding around the antique "arthropod" module, here there be bugs!*/AAAACTCTTATCTATTTATTCATCTATCATTCATCTATCATCT ACTACTATCTAATCTATACA//haha nice hackACTCTACTATAGATCGATGT

SNPs

[Michael Woodhams]

From the fine article:
"The scientists also identified 4,500 new SNPs -- single nucleotide polymorphisms -- which are the variations in human DNA that make people unique."

There are other variations which make us unique.
Alternate alleles*
Indels (insertions/deletions)
Variable numbers of repeats.*

The genetic code uses 4 letters, but I'll use English for explaination.
A SNP is a single letter which has different values in different individuals: "The cat and the dog" vs "the hat and the dog".
An indel is where letters have been inserted into one sequence or deleted from another (without additional data, we can't distinguish these possibilities.)
"The cat and the dog" vs "the cat and the big dog".
In alternate alleles there are a bunch of changes which always stick together, e.g. we observe "the cat and the big dog" and "the cat and the small mouse", but never (or exceedingly rarely) "the cat and the big mouse" or "the cat and the small dog."
Variable repeats are a special case of indels, but common enough to warrant a category of their own. "The cat and and and the dog" vs "the cat and and and and and the dog".

Re:SNPs

[LS]

Thanks for the "plain" English, now again WTF are you talking about? I have no idea. Your comparisons in quotes make no sense. cat vs hat? big vs small? cat vs dog? What are these supposed to represent again?

Re:SNPs

[cnettel]

I don't see why you would mention alternate alleles as something different. They're just SNPs kept closely together, or even indels within the coding sequence. (And some other traits have been shown to actually be varying repeat lengths, as well.) From a phenotypic perspective different alleles are naturally different than "hidden" markers, and of course we have a significant selection pressure on that material, but they're still not a different kind of variation.

Re:SNPs

[macklin01]

Interesting post. I noticed that the "Variable numbers of repeats" looks a lot like microsatellite instability (MSI), where extra copies of short sequences get inserted. Like ATATAT becomes ATATATAT. I'm not entirely up-to-date on what happens as a result, but certainly the encoded protein may lose or alter its function. This type of genetic instability is characteristic of certain types of cancer, like certain colorectal cancers, particularly when a mutation knocks out a crucial repair pathway gene.

Do

Finally!

[Tehrasha]

So we can start compiling from source code now! We better get this covered under the GPL quickly.

3,141 genes

[Iznogood]

pi * 1000 genes. Got to love those fun coincidences.

Re:3,141 genes

[pchan-]

You seem to be under the impression that the number 1000 has some special meaning. Let's try your comment again, in octal:

pi * 1750 genes. Got to love those fun coincidences

Not so exciting now, is it? Nature is not decimal-based. The only reason we tend to be is because of the number of fingers we have.

Re:3,141 genes

[vrt3]

Indeed, and the number of fingers we have is specified in the genes, so maybe it's not a coincidence after all?

Re:3,141 genes

[Opportunist]

Actually there are a few "numbers" that are "magic" in nature. Depending on the species.

10 certainly is important to us, having 10 fingers and 10 toes. Unless you're carpenter.
Asking a bee, you'd prolly be called crazy and 6 is the perfect number, from legs to comb.
A spider would probably tell you 8 is more important, from legs to their web's segments.

But since this genome has meaning for us, I'd wager that our "magic" applies.

Re:3,141 genes

[Opportunist]

Superiority by having the bigger foot.

Re:3,141 genes

[grolschie]

mmmmMMMMM...... 1000 pies and my jeans won't fit anymore. Co-incidence?

Re:3,141 genes

[gwayne]

That's no coincidence, it's the circle of life...

One serious thing left to do

[daemonenwind]

Wake me when they make Cobra Commander.

Joey stole mine when I was 12. He rocked.

Re:One serious thing left to do

[Aeonite]

I think what you're referring to is Serpentor, The Emperor, who was made *by* Cobra Commander from the DNA of the world's most evil people.

http://en.wikipedia.org/wiki/Serpentor [wikipedia.org]

protein modelling

[sc0p3]

This is good news but not too useful until we can model protein shaping.

The AGCT's code for proteins and so far we can only model very short combinations. All you coders keen for a life project have a crack at it. Theres 20 amino acids formed from combinations of three base pairs. The amino acids have attraction and repulsion properties with each other and their environment and form to make a unique shape. Its the analysis of that 3D shape that will solve:

- all cancer - modelling protein shapes means instant cancer cures
- bird flu - again modelling proteins means instant antibodies to diseases
- the most toxic substance ever invented - it will also open up designer drugs

Re:protein modelling

[Charcharodon]

It's already underway. Take a look see at http://www.grid.org/projects/ [grid.org]

Better yet download the client and throw some spare CPU cycles into the mix.

Re:protein modelling

[k98sven]

All you coders keen for a life project have a crack at it.

You do know it's not primarily a programming issue?


Its the analysis of that 3D shape that will solve:
- all cancer - modelling protein shapes means instant cancer cures


Nonsense. Knowing the shape of a protein does not cure cancer in itself. You do know that the structures of thousands of proteins, hundreds of which are cancer related, are already known?

bird flu - again modelling proteins means instant antibodies to diseases

No, knowing the structure o

Re:protein modelling

[Dr. GeneMachine]

Sorry to say that, but you are overly optimistic here, as k98Sven stated above. I work in structural biochemistry, so let me clear up a few points here:

First of all, you can't at the moment crack the protein folding problem by throwing more computational power at it. We still lack lots on insight into many of the fundamental forces governing protein folding. Electrostatics at that level are a nasty thing, for example. The scale of the system would require a quantum mechanical treatment, but then again the

and then there was a two...!

[Anonymous Coward]

gtcatgcgatacgtaggcaaatcg2tgacggcagt

hmmm i guess its not as funny unless its binary

How do they know it's a "gene"?

[jerometremblay]

How do they differentiate junk dna from genes?

I undestand that even if they don't know what a gene is doing, they can single it out from the rest of the dna. How do they do that?

What makes a gene a gene?

Re:How do they know it's a "gene"?

[onco_p53]

What makes a gene a gene

Well all genes start with the sequence "ATG" and end with a stop sequence eg. "TGA" (there are several). See http://en.wikipedia.org/wiki/Codon [wikipedia.org]

There are a lot of exceptions to all of this, eg. stop codons, RNAs, psuedo genes ect.. But it is generally true from a computational point of view.

Re:How do they know it's a "gene"?

[kromer]

The answer, for bacteria and yeast genes are used to make protein. They start with a 3-base sequence that signals "start making protein," have some sequences that tell the cell which amino acids to put together to make the protein, and end with a 3-base sequence that signals "stop making protien." 3-base "stop" sequences occurs pretty frequently in the genome (just by random chance), so, if you find a long sequence that doesn't have a "stop" sequence, you can be pretty sure it's a gene. For more complicat

Re:How do they know it's a "gene"?

[cnettel]

In addition to what's already been mentioned, there are some highly characteristic start sequences "upstream" from the actual coding sequence, including what's called a "TATA box", a sequence of about eight nucleotides, where the most preserved part is TATA. The individual nucleotides vary a little, but it's still quite detectable in the overall noise.

In addition, we have other effects. For example, there is a varying stability between GC and AT pairs, which gives a tendency to a biased ratio in "junk". Th

Re:Genes make proteins.

[WickedScorp]

Many genes make proteins, but not all. Genes are expressed into RNA. Ribosomal RNA genes don't make protein; instead they make RNA contribution to the ribosome.

I'll bet this will make really great...

[Weaselmancer]

...rice. [organicconsumers.org]

A dozen sets would be signifigant

[BlueCoder]

A dozen actual people please. It doesn't count if your just mixing chromosones from different people to claim you have a complete DNA decoded; there is no gaurantee that mix of dna would be viable. There ought to be a panel of scientists to select 12 people to have their DNA read that are willing to be studied for the rest of their lives. Six men and six women. At least some of which would be siblings. Only then can you actually decode DNA. You'll get 90% of the answers there.

You always go with a base

Re:A dozen sets would be signifigant

[cnettel]

True, rearrangements do happen and, true, there is some chance that you have two lucky mutations in the same chromosome that each by itself is lethal. On the other hand, almost all haploid subsets of your genome are carrying lethal traits. So, what you request is sequencing of both copies. We want to get there, sometime, but if we should look for errors, I think the issues of being sure that the full contig sequence is the "true" one are more important, especially in repeat-rich sections.

The current data i

Yay! This means...

[RyuuzakiTetsuya]

The L'Enfants Terrible Project can get underway.

Just... 30 years too late.

Great But...

[bill_mcgonigle]

This is obviously great and all, but didn't they announce the Human Genome Project was complete 3 years ago?

Re:Great But...

[Prof.Phreak]

Indeed. And it will be complete once again in a few years.

Once you get beyond a certain point of "complete", there is no real boundary from where you can claim to be more complete than before.

Re:Great But...

[lbbros]

Completing the sequence and actually putting it together are two entirely different affairs. Small sequences called ESTs (Expressed Sequence Tags) were obtained during this effort. The big task after that was to put everything together AND in order. Think of it as a massive puzzle. Even the genome has different "builds" depending on the level of completeness of this work.

Slow

[Joebert]

At that rate, it must be a group made entirely of male scientists.

All I have to do is open my mouth once & any female can sequence my genes instantly.
Their accuracy is amazing, I always get the same conclusion, "You're an asshole !".

3,141 genes?

[SashaM]

Did anyone else find the number 3,141 [google.com] interesting? Is that a coincidence, or is there a good reason?

Re:3,141 genes?

[ltbarcly]

Yea, especially since you have exactly 3,141.59... genes.

And the distance from the base of the Great Pyramid is exactly twice the distance times 3/23 - the number of pounds in a dozen African Eliphants minus the sum of them... ... you get 666! Therefore, your genes are the antichrist. We should change public policy to better fit with this.

Finished my ass

[pugdk]

There are still large gaps in each chromosome, either due to repetitive sequences, high GC content or closeness to the centromere - basically saying that the human genome is finally done is like saying that 99.9% equals 100%, which it doesn't. This is especially important in cases where you actually NEED to use sequence in areas where it has not been assembled correctly or has not been sequenced... which has happend to me multiple times during the last couple of years... oh and those places in the genome have been unfinished ever since the first installment appeared publicly... they are even lacking in the Celera version of the genome... Finished my ass! -pug

Human genome is not finished

[ill dillettante]

It is actually only about 75% complete - basically the scientist involved have no idea how to finish the remaining sections (mostly simple repeats) so they have "defined" the genome complete by saying that these regions are unimportant.

This is by my count the fourth time that the human genome has been announced "finished" - anymore times and they will all be invited to become slashdot editors.

Re:Ah yes...

[QuantumG]

That movie has a lot to answer for. Unfortunately the level of public education in these matters hasn't gone up much since then. Which is a shame, because soon the technology will exist that allows us to cheaply sequence anyone or anything's DNA. The potential health benefits of such technology are extraordinary. Imagine going to the doctor with a cough. The doctor takes a sample of your phlegm and ten seconds later has a full genetic sequence of the virus that has infected you. Matching it against a

Re:Ah yes...

[WickedScorp]

I'm forced to agree with QuantumG. I'm a Human Geneticist and the genome project is an invaluable tool in the study of human disease. I can understand the fear of the misuse of the technology, but do you think that part of the genome should have been left unsequenced? If so which parts? What would be the benefit of such and action? This technology has allowed for the development of the ability to rapidly screen for the many know disease mutations to assess risk for "genetic" disease. It has also had practi

Re:Ah yes...

[19thNervousBreakdown]

I'm a Human Geneticist

Just who I was looking for!

I've been hearing about genome sequencing for years now, and looked it up on Wikipedia and Google, but for the life of me I can't find out what it actually is, or what it tells you. I know it doesn't tell you what each gene does, although the first time I heard about it, before I thought about it I thought that might be it. Obviously, for any given species the majority of genes are going to be the same. Is sequencing finding out which ones have to be the sa

Re:Ah yes...

[WickedScorp]

The basic idea is this. Our cells need a program that tells them what to do. That's the genome. There are a total of 46 chromosomes consisting of two sets of 23 independent chromosomes (1 - 22 and X or Y). DNA makes up the chromsomes. It's just a chemical structure that stores information; the four chemicals that make up DNA are Adenine (A), Thymidine (T), Cytosine (C) and Guanine (G). Every DNA molecule is actually two pieces of DNA that pair together as A binding to T and C binding to G. Sequencing is a c

Re:Ah yes...

[fyngyrz]

I have questions also, if you'll indulge me:

When we say that "the gene for xxxx is located at yyyy

This means that we *do* know where the particular controlling sequence is located?

Viral gene therapy is a process that can locate the target gene somehow and replace the sequence there with a new sequence?

Does the sequence have to be broken, segmented, and re-built for viral gene therapy? Or is there a "merge" type of operation that "overlays" the new information?

I have read a great deal that in a han

Re:Ah yes...

[Charcharodon]

Gattaca is not a bad thing. If ever there were something in health care the gov't should be providing for free it is this. If everyone is born healthy, with a high resistance to disease, stable body chemistry, and a tendency towards a long active life this would not be a bad thing.

You are right though, genes only create the starting point and set the absolute limits, environment and life experience paint the rest of the picture.

Re:Have they found the gene

[barefootgenius]

It was a joke, and a valid question. In terms of boxing, I have heard some pacific peoples should make better boxers because of their skull design. Look at some sports and see the mix of ethnicity. Is it due to economics, culture? Are you going to refuse to look at possible genetic differences because you feel that is racist? It is mainly just a difference of melatonin after all. Or do we say that because we haven't bothered to look. I would rather know the truth that dismiss something because of a p

Re:Have they found the gene

[LordLucless]

All other factors being equal, having a more resilient skull will make you a better boxer.

It's pretty freaking obvious that there are genetic differences between races. That means there is quite a distinct possiblity that the expression of these differences is going to create affinities for certain activities within various races. Saying "some races are better than others at certain things" isn't racism - it's saying what anyone whose watched the Olympics can tell you. Of course, that doesn't necessarily

Re:Have they found the gene

[AnalystX]

Skull design was obviously just one example, but I can't help but ask, isn't the boxer that lasts longer generally the winner? If one wins at boxing more than everyone else, that most certainly qualifies him as a better boxer. I think you may have confused excelling at a sport with excelling at one aspect of it (punching).

Re:Have they found the gene

[LordLucless]

Blacks were bred to have more physical ability by slave owners, much like dog breeds were bred to encourage certain traits. There is no gene for it and these qualities will in fact recede over time.

You do realize that breeding like to like is genetic manipulation? That what you are essentially doing is reinforcing genes that express the desirous trait and eliminating genes that don't? Physical ability may have been bred in to certain people, as you suggest, and it may recede over time, but it's still a g