Slashdot Log In
Wikipedia To Host Human Gene Repository
Posted by
CmdrTaco
on Thu Jul 10, 2008 08:55 AM
from the hope-i-can-anonymously-edit-it dept.
from the hope-i-can-anonymously-edit-it dept.
schliz writes "US scientists are developing a 'Gene Wiki' with the aim of fostering a flexible, organic archive of human genetic information. The project exists within Wikipedia, and is expected to speed up the process of deciphering genome sequences."
Related Stories
This discussion has been archived.
No new comments can be posted.
The Fine Print: The following comments are owned by whoever posted them. We are not responsible for them in any way.
Full
Abbreviated
Hidden
Loading... please wait.
I saw it on Wikipedia (Score:5, Funny)
Re: (Score:1, Funny)
It says that gene #45A79 controls glowing in the dark! It must be true!
I for one welcome our new phosphorescent, dna-engineered overlords!
Re: (Score:1)
Well, I for one welcome our snooty, buzz-killing overlords.
Re:I saw it on Wikipedia (Score:4, Funny)
Parent
Original research? (Score:2, Interesting)
Re:Original research? (Score:5, Interesting)
Citation needed? ^_^
Should we start a pool on how quickly the project is tagged for speedy deletion due to lack of noteability?
Parent
Re:Original research? (Score:5, Funny)
Should we perhaps call it a gene pool?
Parent
Re: (Score:2)
Don't get me wrong, I think Wikipedia does serve a valuable purpose. But I'm sad that the stock knee-jerk joke concerning anything on Wikipedia the project turned out not to be a joke in this case. Seriously, sometimes following back scenes of that site makes me wonder if the inmates aren't running the asylum and getting ready to burn it to the ground.
Re: (Score:2)
Re: (Score:3, Funny)
Re: (Score:2, Funny)
This is all backwards and wiki should know better. The site will be more popular with less jeans.
Re: (Score:2)
P.S. I work for a genetic facility :)
P.P.S. the biggest need IMHO in the industry is a means to get a list of genes that are "similar" to the one that you are working for. It requires a bunch of complex manipulation of the data, I can't see how putting stuff in a simple text based search system will help.
Re: (Score:2, Informative)
That sounds like BLAST, which if you work in genetics you've undoubtedly heard of, so maybe I don't understand what you're talking about?
Re: (Score:2)
Re: (Score:2)
Re:Original research? (Score:5, Interesting)
I could be wrong, but doesn't wiki allow you to submit your research as long as it's been published somewhere you can reference? If you discover a gene, you're going to publish it somewhere you can put on your CV.
Anyway, this will be pretty redundant. NCBI already has a gene database that is well crosslinked.
http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene [nih.gov]
As this database is powered by published research and updated by a government sponsored organization, it also cannot easily be vandalized, unlike wiki.
Lastly, a lot of researchers put information about their favorite gene up on wiki currently.
Example: reelin. I couldn't help noticing the last time I looked that one of the major contributors was referencing her own (peer-reviewed published) research on reelin.
Parent
Re: (Score:2)
I have to agree, what NCBI has accomplished with Entrez [nih.gov] is pretty amazing. Check out the 'Gene' page for any given gene [nih.gov]. Not only do you get the sequence of the gene, transcript, and gene product, but they have literature references, a list of interacting proteins, all sorts of metadata from the Gene Ontology project. If that's not enough, just about any sequence analysis tool out there will accept an NCBI RefSeq ID, making it incredibly easy to use this data any way you want.
Re: (Score:2)
Re: (Score:2)
Re: (Score:2)
GATTA (Score:3, Funny)
TAGGATTACACCT
Yo Yo I gots my GAT
rat a tat tat anotha nigga on his BAAACK
Steve W sucks cock! lol!!!1
16:04, 10 July 2008 86.75.30.9 (Talk) (3,808 bytes) (undo vandalism... maybe this shouldn't be a wiki)
Re: (Score:2)
Parent is a statement about vandalism, this isn't a troll post. Read the last line and engage your brain for a few seconds.
I'm picturing.. (Score:1)
the revert wars between evolutionists and creationists.
"Ha ha, edit these articles and we can PROVE common ancestry between apes and humans!"
"WTF, I've been reverted for vandalism!??!"
What could possibly go wrong? (Score:4, Insightful)
I've seen enough errors, sloppiness, and outright sabotage on Wikipedia to be highly skeptical when, as TFA says,
What safeguards will be in place to make sure the information in this Wiki is trustworthy and reliable? Think for a moment about the potential consequences.
Re: (Score:1)
Re: (Score:2)
Re:What could possibly go wrong? (Score:4, Funny)
Well -- when you get right down to it, the human genome itself is full of errors, sloppiness, and outright sabotage, so I can't really think of a better host for it.
Parent
Re: (Score:2)
>>Well -- when you get right down to it, the human genome itself is full of errors, sloppiness, and outright sabotage, so I can't really think of a better host for it.
Intelligent Design. There can be no errors as God is perfect. Therefore your just not smart enough to understand it.
Laugh as it is the best counter to ID ever.
Re: (Score:2)
While I am no longer a Christian, if I were I'd point out that in the bible, God introduced imperfection and suffering into the world after Adam and Eve fell. Damaging the gene structure seems a good way to introduce death and disease..
As someone who's seen things from both side of the fence - and honestly believed them rather than just tried to understand those who believed them - that doesn't seem a good counter to me. I'd personally first point out more obvious things like the existence of the human appe
Re: (Score:1)
I think the big fear is that genes are a highly specialized area, and I'd be very scared if a doctor of mine went on Wikipedia to try to cure a fatal genetic disease I had.
Doctors are pretty bright people, though, and my bet is they'll use it the same way as other bright researchers. They'll use it to discover possibilities, get an overview of something, or find further sources to exp
Re: (Score:1)
There's the safeguard of "everything remotely relevant when it comes to genes is published and independantly verifyable." At best this will be a quickly searcheable index with a little blurby summary and links to the actual information. If you're wondering what a gene is and if it might possibly be relevant to your research, this might be quicker than doing a pubmed search and finding a 20 page review article detailing everything known about it.
Of course, you can usually just read the intro or abstract to
Re: (Score:2)
I think you're underestimating the number of immature (or viciously competitive and unscrupulous) researchers out there.
Unless you've found a way to make a buck off zebrafish fibroblast
Re: (Score:1)
Not to say that wikigene will always be accurate and there NEVER will be vandalism.
Of course, this goes for peer-reviewed articles too. According to at least one guy, most of them are wrong.
http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1182327 [nih.gov]
So the potential for incorrect information really is not unique to this thing. Only the Pope claims infallibility, and frankly he's never proven it.
But will wikigene be completely biological companies lying about their gene of interest and corrupt scienti
Re: (Score:2)
Agreed. My point is, the risks of open access (fraud, sabotage, bad research) seem pretty significant. People's lives are potentially at stake. Do you really trust the commons that much? I don't.
Re: (Score:2)
Now you're really putting a lot of faith in the biotech industry. ;-) You're definitely right: it should be.
on a more serious note..... (Score:1)
Nice try guys, but I think this is doomed to fail due to the time pressures that most experts who would be able to contribute to this wiki operate under.
Editing the Human Genome (Score:5, Funny)
Heh. The type of graffiti that will be put on these sites should be good. I can see it now...
Title: Bill Gates Genome
ATATCGGCGCGCTAVISTASUCKSATGCGCCGCGCG
Title: Linus Torvalds Genome
ATTATATACGYAYOPENSOURCETAGCCGCGATCG
Title: Cowboy Neal Genome
ATATCGGCCGGCGCGCATTATATATAIVOTEDFORNEALCGTAATAT
Re: (Score:2)
Title: The "Indian Car Company Makes 'All Terrain Armored Transport' Vehicles for Star Wars Fans" genome?
TATATATAATATATATTATATATAATATATAT
Whose? (Score:2)
Whenever they talk about these human genome projects (including the guys who can sequence it in a matter of weeks [wikipedia.org]) I always wonder whose genome they're talking about. How long before this become a privacy issue?
Re: (Score:2)
The original public genome project (the 'reference genome you'll find on sites like UCSC's, NCBI's and EnsEMBL) used a mixed pool of DNA from several anonymous individuals for sequencing. The private (Celera) project was also a pool (of 5), though we now know most came from the project leader, Craig Venter. Since then, Venter's 'pure' genome has been published, as has that of (DNA structure co-discoverer) James Watson. There'll be many more genomes in the near future, generated using various 'next generatio
A similar wiki already exists (Score:2)
I am going to build a "Wiki-stein" (Score:2)
Oh, no you don't! (Score:4, Funny)
I just KNOW that every time I post my genetic information up there, some wise-a** leftist is gonna "correct" it to give me more "compassion," "understanding," and "desire to eat foreign cuisine."
I'll be sitting there in my recliner watching The History Channel's week-long series on "Hitler's Secret Weapons" when I'm seized with an overwhelming desire to change the channel to "Oprah."
The Left rules Wikipedia; I'll be d*mned if there gonna get at MY genome!
Re: (Score:2)
The Left rules Wikipedia; I'll be d*mned if there gonna get at MY genome!
Or even want to.
Have Faith (Score:2)
I think this project will end up giving more credibility to the wiki way.
What do you want to bet... (Score:1)
Re: (Score:1)
But will you want to deal with the side effects?
(Kind of like Olean, only better...)
Shouldn't this be on Google? (Score:2)
Am I the only one who thinks this "map" should be on Google maps instead of Wikipedia?
I for one would love to see a "You Are Here" Google pin in the gene pool...
Link (Score:1)
In case anybody wanted to look at it on Wikipedia.
Re: (Score:1)