Stories
Slash Boxes
Comments

News for nerds, stuff that matters

Slashdot Log In

Log In

Create Account  |  Retrieve Password

Wikipedia To Host Human Gene Repository

Posted by CmdrTaco on Thu Jul 10, 2008 08:55 AM
from the hope-i-can-anonymously-edit-it dept.
schliz writes "US scientists are developing a 'Gene Wiki' with the aim of fostering a flexible, organic archive of human genetic information. The project exists within Wikipedia, and is expected to speed up the process of deciphering genome sequences."
+ -
story

Related Stories

This discussion has been archived. No new comments can be posted.
The Fine Print: The following comments are owned by whoever posted them. We are not responsible for them in any way.
 Full
 Abbreviated
 Hidden
More
Loading... please wait.
  • by omnichad (1198475) on Thursday July 10 2008, @08:57AM (#24133235) Homepage
    It says that gene #45A79 controls glowing in the dark! It must be true!
  • the article states that the researchers hope to speed up research by doing this, and goes on to say that they're using a computer program to copy the information into Wikipedia... If the only thing they are doing is copying data to Wikipedia, how will this speed up research? It's against Wikipedia's rules to post original research, so I'm assuming this is all they CAN do. While it is neat, I'm not sure I understand how this will speed up new research...
    • by Chyeld (713439) <chyeld AT newsguy DOT com> on Thursday July 10 2008, @09:03AM (#24133335)

      Citation needed? ^_^

      Should we start a pool on how quickly the project is tagged for speedy deletion due to lack of noteability?

      • by Insightfill (554828) on Thursday July 10 2008, @12:00PM (#24137679) Homepage

        Should we start a pool on how quickly the project is tagged for speedy deletion due to lack of noteability?

        Should we perhaps call it a gene pool?

        • Don't get me wrong, I think Wikipedia does serve a valuable purpose. But I'm sad that the stock knee-jerk joke concerning anything on Wikipedia the project turned out not to be a joke in this case. Seriously, sometimes following back scenes of that site makes me wonder if the inmates aren't running the asylum and getting ready to burn it to the ground.

    • Well...anyone can post a gene. That means more information, right? I've already made up 50.
      • This is all backwards and wiki should know better. The site will be more popular with less jeans.

    • They can now easy show prior art for patent claims. Thus getting more money, thus paying for more labrats/equipment to get more patents. Ad nausium.

      P.S. I work for a genetic facility :)

      P.P.S. the biggest need IMHO in the industry is a means to get a list of genes that are "similar" to the one that you are working for. It requires a bunch of complex manipulation of the data, I can't see how putting stuff in a simple text based search system will help.

      • Re: (Score:2, Informative)

        P.P.S. the biggest need IMHO in the industry is a means to get a list of genes that are "similar" to the one that you are working for.

        That sounds like BLAST, which if you work in genetics you've undoubtedly heard of, so maybe I don't understand what you're talking about?

        • He didn't say he worked in genetics, he said he worked in a genetic facility. I wouldn't expect the janitor to know what BLAST was. ;)
          • Not a janitor an IT guy. We have a separate bioinformatics group which would have a much deeper understanding of BLAST than I, but from what I've seen of it it seems like a really crappy system that has become a standard that everyone is comfortable with and reluctant to give up. For example (may be it is the type of problem I don't know) but I know of groups that run blast queries and it pretty much touches every element in the database. It it was in a properly indexed database a lot of the data presumably
    • by philspear (1142299) on Thursday July 10 2008, @09:13AM (#24133553)

      I could be wrong, but doesn't wiki allow you to submit your research as long as it's been published somewhere you can reference? If you discover a gene, you're going to publish it somewhere you can put on your CV.

      Anyway, this will be pretty redundant. NCBI already has a gene database that is well crosslinked.

      http://www.ncbi.nlm.nih.gov/sites/entrez?db=gene [nih.gov]

      As this database is powered by published research and updated by a government sponsored organization, it also cannot easily be vandalized, unlike wiki.

      Lastly, a lot of researchers put information about their favorite gene up on wiki currently.
      Example: reelin. I couldn't help noticing the last time I looked that one of the major contributors was referencing her own (peer-reviewed published) research on reelin.

      • I have to agree, what NCBI has accomplished with Entrez [nih.gov] is pretty amazing. Check out the 'Gene' page for any given gene [nih.gov]. Not only do you get the sequence of the gene, transcript, and gene product, but they have literature references, a list of interacting proteins, all sorts of metadata from the Gene Ontology project. If that's not enough, just about any sequence analysis tool out there will accept an NCBI RefSeq ID, making it incredibly easy to use this data any way you want.

      • Not to mention that the database you mention comes with a really bad ass set of tools for analyzing and downloading various datasets. Used it for a little project in school (trying to find the start of introns using Renyi entropy, it didn't work). You can get access to the database directly from the command line, or from Matlab. Which makes it much more useful than a wiki.
    • Is it going into Wikipedia proper, or is it a separate wiki hosted by the parent organization, the Wikimedia Foundation? I'm betting on the latter. Genes are largely unencyclopedic.
    • If someone is an expert in their field, and they're not posting something like an ad or promotional material, Wikipedia has guidelines to allow for that material to be added. No one in their right mind would, for example, deny Stephen Hawking adding to a physics article, even one that discusses Hawking Radiation.
  • GATTA (Score:3, Funny)

    by BadAnalogyGuy (945258) <BadAnalogyGuy@gmail.com> on Thursday July 10 2008, @09:00AM (#24133277)

    TAGGATTACACCT

    Yo Yo I gots my GAT
    rat a tat tat anotha nigga on his BAAACK

    Steve W sucks cock! lol!!!1

    16:04, 10 July 2008 86.75.30.9 (Talk) (3,808 bytes) (undo vandalism... maybe this shouldn't be a wiki)

    • Parent is a statement about vandalism, this isn't a troll post. Read the last line and engage your brain for a few seconds.

  • the revert wars between evolutionists and creationists.

    "Ha ha, edit these articles and we can PROVE common ancestry between apes and humans!"

    "WTF, I've been reverted for vandalism!??!"

  • by SirGarlon (845873) on Thursday July 10 2008, @09:05AM (#24133391)

    I've seen enough errors, sloppiness, and outright sabotage on Wikipedia to be highly skeptical when, as TFA says,

    The stub articles are expected to seed the posting of more detailed information by Wikipedia users.

    What safeguards will be in place to make sure the information in this Wiki is trustworthy and reliable? Think for a moment about the potential consequences.

    • Genetic mutation? Wikipedia's got cancer!!!
    • Honestly in all my years of searching Wikipedia, there has been little inaccuracies that I have ever saw. Ignoring a few things that are obvious vandalism (for example, if you can't figure out that an article with "Llama" randomly in it isn't vandalism, then you should go back to first grade). But as for errors, I haven't noticed very many of them, about the only things are some weasel words here and there, but that doesn't change much about the information itself.
    • by jesdynf (42915) on Thursday July 10 2008, @09:27AM (#24133805) Homepage

      Well -- when you get right down to it, the human genome itself is full of errors, sloppiness, and outright sabotage, so I can't really think of a better host for it.

      • >>Well -- when you get right down to it, the human genome itself is full of errors, sloppiness, and outright sabotage, so I can't really think of a better host for it.

        Intelligent Design. There can be no errors as God is perfect. Therefore your just not smart enough to understand it.

        Laugh as it is the best counter to ID ever.

        • While I am no longer a Christian, if I were I'd point out that in the bible, God introduced imperfection and suffering into the world after Adam and Eve fell. Damaging the gene structure seems a good way to introduce death and disease..

          As someone who's seen things from both side of the fence - and honestly believed them rather than just tried to understand those who believed them - that doesn't seem a good counter to me. I'd personally first point out more obvious things like the existence of the human appe

    • Wikipedia has been shown to be at least as reliable as other encyclopedic sources. Why would this be different for genes?

      I think the big fear is that genes are a highly specialized area, and I'd be very scared if a doctor of mine went on Wikipedia to try to cure a fatal genetic disease I had.

      Doctors are pretty bright people, though, and my bet is they'll use it the same way as other bright researchers. They'll use it to discover possibilities, get an overview of something, or find further sources to exp
    • There's the safeguard of "everything remotely relevant when it comes to genes is published and independantly verifyable." At best this will be a quickly searcheable index with a little blurby summary and links to the actual information. If you're wondering what a gene is and if it might possibly be relevant to your research, this might be quicker than doing a pubmed search and finding a 20 page review article detailing everything known about it.

      Of course, you can usually just read the intro or abstract to

      • As long as immature researchers don't try to resolve a controversy via wiki vandalism instead of research and logic, there won't be much.

        I think you're underestimating the number of immature (or viciously competitive and unscrupulous) researchers out there.

        If you're going to vandalize something, you're probably going to want do do it on something with a wider audience, like the page on George Bush, not zebrafish fibroblast growth factor 21A.

        Unless you've found a way to make a buck off zebrafish fibroblast

        • Not to say that wikigene will always be accurate and there NEVER will be vandalism.

          Of course, this goes for peer-reviewed articles too. According to at least one guy, most of them are wrong.

          http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=1182327 [nih.gov]

          So the potential for incorrect information really is not unique to this thing. Only the Pope claims infallibility, and frankly he's never proven it.

          But will wikigene be completely biological companies lying about their gene of interest and corrupt scienti

          • But will wikigene be completely biological companies lying about their gene of interest and corrupt scientists trying to prove their research? Doubtful.

            Agreed. My point is, the risks of open access (fraud, sabotage, bad research) seem pretty significant. People's lives are potentially at stake. Do you really trust the commons that much? I don't.

              • Any medical treatment relating to genetics should be based on more than a wiki article or even a single peer-reviewed article in a respected journal.

                Now you're really putting a lot of faith in the biotech industry. ;-) You're definitely right: it should be.

  • The "long tail" principle doesn't seem to fit this idea, since there are only a small number of experts in any gene, rather than the large number that the authors of the PLOS article seem to think. I also believe curated gene annotation has been tried before with the Genome DataBase (GDB), which has recently folded.

    Nice try guys, but I think this is doomed to fail due to the time pressures that most experts who would be able to contribute to this wiki operate under.

  • by D Ninja (825055) on Thursday July 10 2008, @09:16AM (#24133613)

    Heh. The type of graffiti that will be put on these sites should be good. I can see it now...

    Title: Bill Gates Genome
    ATATCGGCGCGCTAVISTASUCKSATGCGCCGCGCG

    Title: Linus Torvalds Genome
    ATTATATACGYAYOPENSOURCETAGCCGCGATCG

    Title: Cowboy Neal Genome
    ATATCGGCCGGCGCGCATTATATATAIVOTEDFORNEALCGTAATAT

    • Title: The "Indian Car Company Makes 'All Terrain Armored Transport' Vehicles for Star Wars Fans" genome?

      TATATATAATATATATTATATATAATATATAT

  • Whenever they talk about these human genome projects (including the guys who can sequence it in a matter of weeks [wikipedia.org]) I always wonder whose genome they're talking about. How long before this become a privacy issue?

    • The original public genome project (the 'reference genome you'll find on sites like UCSC's, NCBI's and EnsEMBL) used a mixed pool of DNA from several anonymous individuals for sequencing. The private (Celera) project was also a pool (of 5), though we now know most came from the project leader, Craig Venter. Since then, Venter's 'pure' genome has been published, as has that of (DNA structure co-discoverer) James Watson. There'll be many more genomes in the near future, generated using various 'next generatio

  • SNPedia [snpedia.com] has been around since August 2006. It's just for SNPs, not entire genes, and focuses on SNPs used in commercial testing, but the layout of SNPedia and the proposed wiki in the paper are fairly similar.
  • A totally artificial human from the pieces I steal from Gene Wiki. It will be able to tap dance and sing too.
  • by Illbay (700081) on Thursday July 10 2008, @10:12AM (#24135027) Journal

    I just KNOW that every time I post my genetic information up there, some wise-a** leftist is gonna "correct" it to give me more "compassion," "understanding," and "desire to eat foreign cuisine."

    I'll be sitting there in my recliner watching The History Channel's week-long series on "Hitler's Secret Weapons" when I'm seized with an overwhelming desire to change the channel to "Oprah."

    The Left rules Wikipedia; I'll be d*mned if there gonna get at MY genome!

  • I, for one, have faith that in the true spirit of wiki, it will be worked, reworked, improved pon, and cross-referenced until it is as good as any reference work.

    I think this project will end up giving more credibility to the wiki way.
  • That when the genome's posted on Wikipedia it'll be pretty easy to find out exactly which gene contains the gene for Wolverine's super healing mutation.
  • Am I the only one who thinks this "map" should be on Google maps instead of Wikipedia?

    I for one would love to see a "You Are Here" Google pin in the gene pool...

  • Link [wikipedia.org]

    In case anybody wanted to look at it on Wikipedia.