Slashdot Log In
Genome of DNA Pioneer Is Deciphered
Posted by
Zonk
on Fri Jun 01, 2007 10:01 PM
from the watson-and-crick-and-franklin-oh-my dept.
from the watson-and-crick-and-franklin-oh-my dept.
unchiujar writes "The New York Times reports that the full genome of James D. Watson, one of the discoverers of the structure of DNA in 1953, has been deciphered, marking what some scientists believe is the gateway to an impending era of personalized genomic medicine. A copy of his genome, recorded on a pair of DVDs, was presented to Dr. Watson on Thursday in a ceremony in Houston by Richard Gibbs, director of the Human Genome Sequencing Center at the Baylor College of Medicine, and by Jonathan Rothberg, founder of the company 454 Life Sciences. 'The first two genome sequences belonging to individuals are now being made available to researchers within a few days of each other. One is Dr. Watson's and the other belongs to J. Craig Venter, who as president of the Celera Corporation started a human genome project in competition with the government. Dr. Venter left Celera after producing only a draft version of a genome, his own, in 2001, which the company did no further work on. He has now brought his genome to completion at his own institute in Rockville, Md., and deposited it last week in GenBank, a public DNA database, he said.'"
Related Stories
[+]
One Species' Genome Discovered Inside Another's 224 comments
slyyy writes "The Universtiy of Rochester has discovered the complete genome of a bacterial parasite inside the genome of the host species. This opens the possibility of exchanging DNA between unrelated species and changing our understanding of the evolutionary process. From the article: 'Before this study, geneticists knew of examples where genes from a parasite had crossed into the host, but such an event was considered a rare anomaly except in very simple organisms. Bacterial DNA is very conspicuous in its structure, so if scientists sequencing a nematode genome, for example, come across bacterial DNA, they would likely discard it, reasonably assuming that it was merely contamination--perhaps a bit of bacteria in the gut of the animal, or on its skin. But those genes may not be contamination. They may very well be in the host's own genome. This is exactly what happened with the original sequencing of the genome of the anannassae fruitfly--the huge Wolbachia insert was discarded from the final assembly, despite the fact that it is part of the fly's genome.'"
This discussion has been archived.
No new comments can be posted.
The Fine Print: The following comments are owned by whoever posted them. We are not responsible for them in any way.
Full
Abbreviated
Hidden
Loading... please wait.
Excuse me Dr. Watson... (Score:4, Funny)
Re:Excuse me Dr. Watson... (Score:5, Informative)
Parent
Is that all I am? (Score:2)
gttgaaatgggacgttgatggggtgatgtctgttcagtcttcgctgttta aaaagtttgggttatttttattgtgaaactgttggggttttctgcacatt ctctagatacaagacccttaccagatttatgtgtgggagtatcccaccca ttctgaattgtgtccctttgtcttcctcatggtgtgcttaatcgttattt aacacttaaccatttttttatggctagtgcttttagccataaagtcctaa gaaatcttttcctacctcaaggtgacaaagatactctcctctgttctatt tttcatttttatattgtacacaacacttaaaaaataagtctaagtgttac tagctgagaaataccagaaaacaacttgcataaatgctgaaatcgaattg ctacccctattttggattgaaatgaatttgaagggggaagaatgtca
Re: (Score:3, Insightful)
Yes, but most of them are not compatible with life, so chances are you don't have any.
Re: (Score:3, Funny)
Re: (Score:2, Funny)
Re: (Score:2, Funny)
gttgaaatgggacgttgatggggtgatgtctgttcagtcttcgctgttt a aaaagtttgggttatttttattgtgaaactgttggggttttctgcacatt ctctagatacaagacccttaccagatttatgtgtgggagtatcccaccca ttctgaattgtgtccctttgtcttcctcatggtgtgcttaatcgttattt aacacttaaccatttttttatggctagtgcttttagccataaagtcctaa gaaatcttttcctacctcaaggtgacaaagatactctcctctgttctatt tttcatttttatattgtacacaacacttaaaaaataagtctaagtgttac tagctgagaaataccagaaaacaacttgcataaatgctgaaatcgaattg ctacccctattttggattgaaatgaatttgaagggggaag
completely torn (Score:3, Interesting)
Re:completely torn (Score:4, Interesting)
- If someone wanted your DNA for malicious purposes would they have any trouble getting it? Unless you're meticulous about security and burn all your trash, it'd be no problem.
- What could they do with your DNA?
- Trace you back to crimes? They can do that already by taking your DNA without consent.
- Clone you? Nope, not yet at least, and what would they do with the clones?
- Discover you have the "criminal gene"? These "criminal/musician/pedophile/libertarian/democrat
" genes are nonsense.
- My cousin did genetics at Oxford and, iirc, his professor told him that genetics wouldn't be useful for much in a long time, even to do good.
The scariest thing I can think of is having a national database of all genetic profiles, as it could have privacy implications. But that would be no scarier than having a national database of all fingerprints (but much more expensive).Parent
Re: (Score:2, Interesting)
Dude, if we mastered electricity, nuclear technology, chemistry, biological warfare and millions of 1+ ton hunks of metal whizzing around at 100km/h all over the the planet's surface, and made humanity benefit from all the above, do you REALLY think personalized medicine as a consequence of knowing your personal genome would do more bad than good to warrant "being afraid of the technology"?
Gimme a break. 1978 called, they want their hitle
Re: (Score:2)
Good result, disappointing scientist / human (Score:5, Informative)
In short, Watson stole a lot of data, and the structure of DNA would have been determined in less than a couple months by the more deserving Linus Pauling, who has conducted himself in a much more dignified fashion. It is really strange how superficial history records events, with the "first" often the most noisy, obnoxious scientist / engineer / artist, and not the industrious, studious type.
Well, perhaps they will find some genes responsible for the "jerk" phenotype... (at work, have to post AC).
Re: (Score:2, Funny)
Well, he was (and still is) of poor character... (Score:5, Informative)
He and his colleagues knowingly stole vital DNA X-ray diffraction data from Rosalind Franklin and Raymond Gosling without their knowledge and consent (indeed, Franklin had even refused to share it), which tarnishes their acheivements.
More recently, he has called for genetic screenings before birth to weed out "really stupid" people (the bottom 10 percent or so), and he has a nice line in how to deal with homosexuality, too. He believes "that if the gene [for homosexuality] were discovered and a woman decided not to give birth to a child that may have a tendency to become homosexual, she should be able to abort the fetus." Not to put too fine a point on it, but that strikes me as being rather too close to Third Reich thinking for my liking.
He might have performed some fantastic science but, to me, his words preclude him from being considered a great scientist. Certainly they show that he's not a great human being.
Parent
Re:Well, he was (and still is) of poor character.. (Score:2)
Re: (Score:3, Informative)
Abortions because of a likelyhood of low IQ or homosexuality? That doesn't abhor you? I'm all for a woman's right to choose not to have a baby (it's her body, it's her choice) but to make that choice available on the basis of likely intelligence or sexuality (or hair colour, or skin tone) is, to me and most people, a step too far.
OK, if a foetus is going to
Re: (Score:2)
Its not a baby or not a human life so its okay to kill it... unless your reason for killing it is wrong because then it is a human life.
If abortion hadn't gotten tied into religion, then everyone with a high school education would accept that on simple biological grounds a fetus is a human life. Claiming otherwise is burying your head in the sand as much as the creationism people.
Re: (Score:2)
Abortion is rarely chosen due to features of the baby. It's generally because of the mother's situation in one way or another.
Eugenics, on the other hand, is based entirely on the baby. It puts people in the position of being able to choose "good" features, and have a "proper" baby. This is dangerous on several levels, potential prejudices in both directions and gene pool reduction being two of the more important ones.
The fact that a fetus is being destroy
Re: (Score:3, Insightful)
If abortion hadn't gotten tied into religion, then everyone with a high school education would accept that on simple biological grounds a fetus is a human life.
A fetus is excluded from the meaning of the legal term "person", because that's easier to do and results in more consistent application of the law than would amending every single law to replace "person" with "person other than a fetus". For similar reasons, corporations are considered legal "persons".
The "fetuses aren't people" argument is a red herring, anyway. Yes, a fetus is a human life, and a chimpanzee is almost a human life. However, in our society, we benefit from offering only very limited
Re: (Score:3, Interesting)
Disclaimer 1: I don't know much about Eugenics so the following may be totally wrong.
Disclaimer 2: I know that 28 Weeks Later was just a movie. Bear with me, I just bring it up to illustrate my theory.
One way Eugenics is potentially bad for the species is that by weeding out undesirable characteristics we reduce genetic diversity. And if diversity decreases and some terrible dise
Re: (Score:2)
No, using more information to make an important decision doesn't seem abhorrent to me at all. A pregnant woman has the right to chose to abort the fetus. It's her body, it's her
Re:Well, he was (and still is) of poor character.. (Score:2)
This always makes me laugh. An inheritable cause for people who kind of by definition can't (or rather won't) have children. Yeah, homosexuality is a "gene"...
Re: (Score:2)
If one or more genes lead to homosexuality or increase the chances of it when they are expressed alone or together, then clearly those genes would need to have other effects alone or toget
Re: (Score:2, Flamebait)
Yeah, the same argument is used to claim the existence of "God", because you can't "disprove it".
I think it is a LOT more likely that homosexuals are so desperate for some sort of justification for their lifestyle to be accepted by society that a "genetic" theory suits them just fine. Aww, it's not THEIR fault. It's a gene.
considering (Score:3, Informative)
Re: (Score:2)
Aborting a homosexual fetus is a little like aborting an Asperger fetus, someone who is just different and who certain segments of society shun, but in the case with Aspergers, the shunning
Re: (Score:2)
Re: (Score:2)
Re: (Score:2)
The same sorts of issues exist with negative results. Nobody cares about them, but they're just as important as positive results. Especially when everybody keeps reinventing t
Re: (Score:3, Informative)
We also can't forget Rosalind Franklin - the "Dark Lady" of DNA [npr.org], who first pohotographed the DNA molecule.
Two DVD disks? (Score:3, Insightful)
Re:Two DVD disks? (Score:5, Interesting)
By my calculations:
3 billion base pairs in the entire human DNA sequence (give or take). Each base pair can be A, C, T, or G. (look at wikipedia or biology text for details.) Thus, each base pair can be represented by a 2 bit number (00 01 11 or 10).
Thus, 3 x 10^9 base pairs * 2 bits / base pair = 6 x 10^9 bits = 6 billion bits * 1 byte / 8 bits =
A standard DVD holds 4.3 GB, so you could fit almost 6 full humans on a DVD. Of course, this doesn't count compression (which would be astoundingly effective given repetition and patterns in DNA sequences) nor the fact you could just encode the delta as much DNA is conserved. In fact, very little DNA varies between humans, so I'd bet you could quite deterministically encode a human in as little as 100 MB if you had a "standard human DNA sequence" for reference.
Of course, you would need some magical method to reconstruct this DNA and put it into an egg at the right timing, which would likely form an approximation of the identical twin of a person. The technology for this is not here yet. Also, this does not encode any of the proteins / apparatus / mother that is needed to go from DNA in egg to functioning human.
Still, it is interesting to think about!
Parent
Re: (Score:2)
How about "cyber synthetic biology"? Basically, digitally grow the organism via emulation. I bet this technology will be used to study and digitally dissect a dinosaur long before one is actually cloned.
Throw enough CPU power at it to emulate neural activity...and it might be "aliv
Re: (Score:3, Interesting)
Only six? (Score:4, Funny)
so you could fit almost 6 full humans on a DVD.
Only six? With lossy compression, you could do significantly better, as long as you don't mind all your offspring being funny-but-similar-looking lactose-intolerant non-deterministic sociopathic freaks.
Parent
Re: (Score:2)
The problem is... (Score:2)
apparently bioinformaticians have never heard of "compression" or "efficient use of space".
The data (and it's associated metadata) is stored into formated ASCII thus the 12-fold increase of space requirement.
[ Also for all wanna-be-DrEvils on
Re: (Score:2)
"How much" depends entirely on your needs.
Limited Rights (Score:5, Funny)
Jumping the gun (Score:2)
Re: (Score:2)
News stories with DNA are always encumbered with misleading inappropriate terms.
Celera = bad news (Score:5, Interesting)
Celera is a bad news company, and news involving them should always set off alarm bells.
They are decent at motivating people, though. Based on their track record and stated intentions they caused a massive movement to decode the human genome as public property after they announced they would compete with the federally funded decoding initiatives for the purpose of patenting the findings and licensing that data to private companies. As John Sulston, who led the British arm of the Human Genome Project put it: 'We were in a position of responsibility... without us, the human genome would be privatized.'
Here's a quote from The New Atlantis:
"Celera's mission was to sequence the human genome better and faster than its government-funded rival. It aimed to sell access to genomic information as well as the tools to interpret it, with an eye to "big pharma" and other biotechnology companies looking for a treasure trove of new drug targets."
Venter, named in the submission, was the CEO of Celera at the time this strategy was developed and was deposed several months after it became clear that the public would beat Celera to the goal.
This is admitedly troll bait, but I feel a burning personal need to inform people about this man's actions whenever I see his name in print.
Regards.
Re: (Score:3, Insightful)
Basically, the issue was that the human genome project was operating under a rather long timeline (mostly based on the state of technology when the project started). Venter thought that using a massively-parallel approach to the problem and using computers to assemble the resulting mess of data would get the results faster, but with some gaps in the final data that would require follow-up. He started Celera to implement this idea.
The business model was simple. All the data would
Nature will find a way... (Score:3, Funny)
2 DVD's? (Score:5, Informative)
On one hand, this is a marginal underestimate because there are more than 4 DNA nucleobases (quite rare, but they exist and need to be recorded if you're profiling a genome).
However, the genome should be quite happily compressable (think bz2 or some specialized lossless form of compression) due to MANY repeating sequences and the fact that most exons (that you'd normally use 6 bits to describe) can be described using 5 bits by pinpointing their product on an amino-acid table (numbering 20 members most of the time), or even 4 bits if you narrow that table from the 20-most-common to the 15-most-common and use the 16th position to describe less-common sequences using more bits, just to name a few reasons.
Maybe a bit of added data they put in describes things we've learned about the data which wasn't physically present in the original DNA such as "here ends intron, here starts exon, here be boundary" etc.
In short, it should be highly compressible and fit in way under 2 DVD's, so for the life of me I can't figure out what they plugged onto two DVDs. Software to decipher it? Gene database correlating what's in your personal genome to what the genes are known to do? Free BonziBuddy extra content? Bonus "behind the scenes" material?
Re: (Score:2, Funny)
I'm pretty certain most people don't want to see their very own "making of" documentaries...
Re: (Score:2, Informative)
The Next Experiment (Score:3, Funny)
Or did that already happen? Are we part of the simulation, doomed to ever repeat our part in the story of Watson's life? It's like that Groundhog's Day movie on
Sorry, I'm very tired...
Re: (Score:2)
Re: (Score:2)
--And coldsleep for myself for ~25 years while they grow up and are educated. (And my $$ earns enough Interest in the BG to pay for it all)
--Can you imagine the conversations... and teh sex?
--They won't be slaves; but they will have a nice profile/background of m