Stories
Slash Boxes
Comments

News for nerds, stuff that matters

Slashdot Log In

Log In

Create Account  |  Retrieve Password

Human Genome Sequencing Completed

Posted by samzenpus on Wed May 17, 2006 08:07 PM
from the all-the-a-t-c-and-g dept.
Arthur Dent '99 writes "According to this article at Reuters, the last chromosome in the human genome has finally been sequenced, taking 150 British and American scientists 10 years to complete. The sequenced chromosome, Chromosome 1, is the largest chromosome, with nearly twice as many genes as the average chromosome, making up eight percent of the human genetic code. The Human Genome Project has published the sequence online in the journal Nature, according to the article. It contains 3,141 genes (over 1,000 of them newly discovered), and 4,500 new SNPs -- single nucleotide polymorphisms -- which are the variations in human DNA that make people unique."
+ -
story
This discussion has been archived. No new comments can be posted.
The Fine Print: The following comments are owned by whoever posted them. We are not responsible for them in any way.
 Full
 Abbreviated
 Hidden
More
Loading... please wait.
  • First Chromosome (Score:5, Interesting)

    by LiquidCoooled (634315) on Wednesday May 17 2006, @08:08PM (#15355353) Homepage Journal
    I won't bore you with the details, but theres lots of GATCAATGAGGTGGACACCAGAGGCGGGGACTTGTAAATAACACTGGGC type things here [sacred-texts.com]
  • So now. (Score:3, Funny)

    by AltGrendel (175092) <ag-slashdot.exit0@us> on Wednesday May 17 2006, @08:10PM (#15355363) Homepage
    Can we start the patent countdown clock?
  • by FhnuZoag (875558) on Wednesday May 17 2006, @08:10PM (#15355365)
    Now where's my +1 Talent in every base?
  • by Anonymous Coward on Wednesday May 17 2006, @08:10PM (#15355368)
    if God wouldn't have used LISP to encode the darn sequence in the first place
      • by Fjornir (516960) on Wednesday May 17 2006, @09:56PM (#15355848)
        You thought wrong [infogroep.be].
        I was taught assembler
        in my second year of school.
        It's kinda like construction work --
        with a toothpick for a tool.
        So when I made my senior year,
        I threw my code away,
        And learned the way to program
        that I still prefer today.

        Now, some folks on the Internet
        put their faith in C++.
        They swear that it's so powerful,
        it's what God used for us.
        And maybe it lets mortals dredge
        their objects from the C.
        But I think that explains
        why only God can make a tree.

        For God wrote in Lisp code
        When he filled the leaves with green.
        The fractal flowers and recursive roots:
        The most lovely hack I've seen.
        And when I ponder snowflakes,
        never finding two the same,
        I know God likes a language
        with its own four-letter name.

        Now, I've used a SUN under Unix,
        so I've seen what C can hold.
        I've surfed for Perls, found what Fortran's for,
        Got that Java stuff down cold.
        Though the chance that I'd write COBOL code
        is a SNOBOL's chance in Hell.
        And I basically hate hieroglyphs,
        so I won't use APL.

        Now, God must know all these languages,
        and a few I haven't named.
        But the Lord made sure, when each sparrow falls,
        that its flesh will be reclaimed.
        And the Lord could not count grains of sand
        with a 32-bit word.
        Who knows where we would go to
        if Lisp weren't what he preferred?

        And God wrote in Lisp code
        Every creature great and small.
        Don't search the disk drive for man.c,
        When the listing's on the wall.
        And when I watch the lightning burn
        Unbelievers to a crisp,
        I know God had six days to work,
        So he wrote it all in Lisp.

        Yes, God had a deadline.
        So he wrote it all in Lisp.
        All credit to Julia Ecklar -- and (I believe) Heather Alexander who is singing the linked copy.
  • by gentimjs (930934) on Wednesday May 17 2006, @08:10PM (#15355371) Journal
    I'll take my next kid with larger-than-average height, enhanced frontal lobes, a natural resistance to the polio virus, OH and dont forget the 20/10 vision!
      • by MBCook (132727) <foobarsoft@foobarsoft.com> on Wednesday May 17 2006, @08:25PM (#15355433) Homepage
        Odd things can be related. I remember hearing about how there were fox fur breeders somewhere (like in Russia). They decided to try to breed tamer foxes so they wouldn't have to worry about getting bit so much. Well after a few generations they succeeded. There was only one problem: all the tame foxes had a big white streak down their back, ruining the pelt. They two traits were related somehow, even though you wouldn't think it.

        So, what if it was a choice between good vision and very high intelligence? How about between good vision or very low risk of cancer/heart disease?

        Bad vision is correctable. If there is a trade off to make, good vision would be something that wouldn't be too hard to trade for something better.

        • by k98sven (324383) on Wednesday May 17 2006, @08:56PM (#15355572) Journal
          They two traits were related somehow, even though you wouldn't think it.

          Which is more of a typical example of Science challenging our preconceptions than actual "oddity".

          To make an analogy, if you came across a switchboard with 100 light bulbs and 100 switches, you'd probably assume each switch turned on a light. Then you'd be confused to discover that some switches turned on two lights, some lights needed several switches to be on, and some switches did nothing at all.

          Of course, if you looked under the hood and saw how the thing was wired, you'd then find that there wasn't actually anything strange going on, just that your assumption of how the thing worked was oversimplified.

          I think this oversimplification is one of the reasons some people have trouble understanding evolution. It's a bit hard to understand how things like heireditary genetic diseases could exist if you assume that it's a completely independent property (and indeed, most of them probably wouldn't exist if it was).

          Another fun example of non-obvious traits in humans is that a single SNP (prevalent in East Asians) causes you to sweat less, but also causes you to have dry and crumbly earwax instead of the gooey, sticky stuff most people have.
        • Odd things can be related. I remember hearing about how there were fox fur breeders somewhere (like in Russia). They decided to try to breed tamer foxes so they wouldn't have to worry about getting bit so much. Well after a few generations they succeeded. There was only one problem: all the tame foxes had a big white streak down their back, ruining the pelt. They two traits were related somehow, even though you wouldn't think it.

          That doesn't mean that the traits will always stay linked. They probably res

        • I'd give smarts for insight any day.

          Sometimes, I'd give intelligence for booze. Life'd be a lot easier and less painful.
              • by Daniel Dvorkin (106857) * on Wednesday May 17 2006, @09:58PM (#15355856) Homepage Journal
                You're just wrong about this. 20/10 means you can resolve something 20 feet away twice as well as the average person; similarly, 20/40 means you can resolve something 20 feet away half as well as the average person. But 20/10 does not mean your eye is misshapen or your sense of perspective is off. It simply means you have better distance vision than average. Now, you may also be "farsighted" -- i.e., have trouble resolving things close up -- but the two are basically independent of each other.

                20/20 isn't "perfect," BTW. Human vision is very good compared to that of most animals, but it's laughably bad compared to that of, e.g., birds of prey. I guarantee you an eagle can see better than you can whether it's spotting a rabbit from a few hundred feet in the air, or staring that same rabbit in the face right before dinnertime. ;)
        • by zeno_2 (518291) on Wednesday May 17 2006, @08:47PM (#15355538)
          Just to add on to this

          20/20 vision means that when you stand away from something at 20ft, what you see is what the normal person would see at 20ft.

          20/40 is, well, if you stand 20ft away, you see what a normal person would see at 40ft

          Same goes for 20/10.
  • A simple question (Score:3, Interesting)

    by helioquake (841463) on Wednesday May 17 2006, @08:18PM (#15355397) Journal
    Why do one chromosone have more genes than others?
    • They are all different sizes. Chromosomes are numbered from largest to smallest 1 - 22 (except 21 and 22; 21 is actually the shortest and 22 is slightly bigger; the mistake was made in early cytogenetics because they couldn't distinguish the sizes well enough and those two were named incorrectly) + X and or Y. So chr 1, being very large, has a very large number of genes just because it's huge. It isn't the most gene dense, however, which is chromosome 19 with more genes / Mb than elsewhere in the genome.
    • by SnowZero (92219) on Wednesday May 17 2006, @08:25PM (#15355434)
      Evolution is a process with a lot of randomness. So I'd instead ask the question: Why would you exepct them to be the same?
    • Re:A simple question (Score:5, Informative)

      by FTL (112112) <slashdotNO@SPAMneil.fraser.name> on Wednesday May 17 2006, @08:30PM (#15355461) Homepage
      > Why do one chromosone have more genes than others?

      Same reason some source code files contain more lines of code than others. They do different things.
        • I also consider that one of the chromosomes could maintain (as a unit) the code for some very complex interaction that can't be further broken down. Maybe something to control the expression of genes, p2p communication (to correlate production of proteins, etc.), or even the definition of types for cell differentiation. Or a kind of file full of unique keys to keep the immune system from attacking the body's own cells (errors in which might result in allergies). Consider the size of concurrency control a

    • Because it evolved (Score:5, Interesting)

      by GrahamCox (741991) on Wednesday May 17 2006, @08:34PM (#15355478) Homepage
      Why do one chromosone have more genes than others

      Why not? It's because it wasn't designed by a computer geek (or anyone/thing else) where you might have said, hrmmm, we need about 30,000 genes for this design, so we'll split that into 26 chromosomes of 1,154 genes apiece. That should do it!

      The fact is, we evolved, and so our components are just bits and pieces taken from all our previous ancestors, modified according to whatever was needed to suit the environment we happened to find ourselves in at the time. As with all natural, biological, dynamic processes, what emerges is often bizarrely disorganised, yet somehow works.
        • by MrP- (45616) <rob.elitemrp@net> on Wednesday May 17 2006, @09:09PM (#15355638) Homepage
          640 chromosomes ought to be enough for anybody!
        • by fyngyrz (762201) on Thursday May 18 2006, @04:52AM (#15356118) Homepage Journal
          Nonsense. We'd design it to have 32 bits to index the chromesomes, 32 bits to index the genes in each chromesome, and an alternate set of registers so you could quickly swap chromesomes for different tasks. You could clock it at any speed, or leave it static, and it'd never lose data. It'd be radiation hardened, low-power, erasable by ultraviolet, reprogramable by anything from dip switches to GHz pulse trains, internally and externally redundant, solar-powered, ecologically friendly, and involve a great deal of caffiene. Primary developmental needs would be met by carefully metered infusions of pizza.

          However, because of technological limitations, only the bottom 4 bits of the gene index would actually be used, with the next 4 bits being set to zero by default, and the remaining 24 bits determining your average skin color.

          Additionally, the 32 bit chromesome index would use 8 bits starting at the MSB, the next 8 bits would be reserved and set to zero, and the remaining 16 bits would be undefined, though later we'd find variations there gave rise to both creationist tendencies and division by zero, leading us towards a new design that is only 16 bits, but ran twice as fast and never divided by zero, or made up answers to questions without having known good data on the input side.

          All other features would be put off for the beta version, because we'd have a little trouble with the alpha we didn't exactly anticipate.

          Unfortunately, all advances gained by this leap in technology would be lost when hardware manufacturers forced new "quantum confusion" technology upon the geeks in a selfish race for more market share. Geeks fail to notice because they're too busy trying to get Genes 0.1 alpha through ANSI committee approval.

          For maximum efficiency, this awesomely fast new technology requires light pipes for communications, however, in a legislative feat worthy of Maltheus himself, congress declares that production of light pipes within the boundaries of any state for use within the boundaries of that state represent interstate commerce of light paraphanalia, and so no one's going to be doing that, thank you. It's all part of the War on Bits. InSmell, primary manufacturer of light pipes in the USA, shuts all production down, fires half its workforce, and its stock goes up by a factor of four.

          At this point, the only light-pipe architecture you can find comes from Japan, and the upper 24 bits of the gene index are all hard-coded to DDDDBB. It is expensive, but everyone buys it anyway. You can only run this hardware in Denmark. Floating (actually, more like drifting) point is emphasized, and virtual reality is experienced by all users, though that is not to say that it is the same virtual reality across the board.

          In the meantime, US geeks invent open-source web 9.0, expend all their energy producing applications for it that have absolutely no merit whatsoever of any kind using the justly famous "Corundum on Wagon Ruts" technology to replace perfectly good desktop apps that already exist, but are really really cool because they can make almost any browser's "Joe" scripting language use all the memory in your computer... subsequently, geeks quietly go extinct while arguing if GPL or PD is the way to go for the open source path.

    • It may seem logical to respond that evolution yields varied results, or throw up hypotheses about the physics involved or whatever the hell you want. But these do not explain cause, and cannot answer why chromosomal size is varied.

      So, if you really want to know, the answer is...

      because.
    • In addition to what the other posters said, the chromosomes are numbered by their size up chromosome 22, then the 23rd pair is the X and/or Y chromosomes. Since this is chromosome 1 we're talking about, it's the largest one.
  • by GoofyBoy (44399) on Wednesday May 17 2006, @08:24PM (#15355424) Journal
    "To map the very stuff of life; to look into the genetic mirror and watch a million generations march past. That, friends, is both our curse and our proudest achievement. For it is in reaching to our beginnings that we begin to learn who we truly are."
          -- Academician Prokhor Zakharov,
          "Address to the Faculty"
    • Why do you insist that the human genetic code is "sacred" or "taboo"? It is a chemical process and nothing more. For that matter -we- are chemical processes and nothing more. If you deny yourself a useful tool simply because it reminds you uncomfortably of your mortality, you have uselessly and pointlessly crippled yourself. - Chairman Sheng-ji Yang, "Looking God in the Eye"

      Complete list of quotes here [generationterrorists.com], although for full effect you really need to hear some of them. The voice acting on Alpha Centauri is amon
  • Oblig. (Score:5, Funny)

    by mk_is_here (912747) on Wednesday May 17 2006, @08:26PM (#15355437)
    Scientists: All your base pair are belong to us!
  • Remember kids... (Score:4, Insightful)

    by TheOldSchooler (850678) on Wednesday May 17 2006, @08:26PM (#15355439)
    Your single nucleotide polymorphisms are unique! Just like everyone else's.
  • by GroeFaZ (850443) on Wednesday May 17 2006, @08:27PM (#15355442)
    ACGATCGTACGcopyrightTAGATCGCGTAGTAGCTAGCTGTbyGGCGG CGGTACGGCTATiehovaAGTCGATCGATGATCG5billionBC-TAGCT AGCTAGCTAGCTAGinfinityTAGTAGTATTTATTTunauthorizedA GGCGGTATGCTAGCTAGreproductionCTGATGTGTAGCCCAprohib itedCCAGCTTAGCTAbyGCTAGCTAGTGTAAATCGCCATCGCGCCTAdi vineTTCTCTAGAGCTTAGCATGCTAlawCGTACGTAGCTA
    • by ggvaidya (747058) on Wednesday May 17 2006, @09:51PM (#15355824) Homepage Journal
      ACTTTTTCGCGAGAGGAGAGTGAGT//todo:this should only return a positive values!AAAAAATTTCTATCTACTATCTACATATCATTACA/*warnin g we are kluding around the antique "arthropod" module, here there be bugs!*/AAAACTCTTATCTATTTATTCATCTATCATTCATCTATCATCT ACTACTATCTAATCTATACA//haha nice hackACTCTACTATAGATCGATGT
  • SNPs (Score:5, Informative)

    by Michael Woodhams (112247) on Wednesday May 17 2006, @08:31PM (#15355463) Journal
    From the fine article:
    "The scientists also identified 4,500 new SNPs -- single nucleotide polymorphisms -- which are the variations in human DNA that make people unique."

    There are other variations which make us unique.
    Alternate alleles*
    Indels (insertions/deletions)
    Variable numbers of repeats.*

    The genetic code uses 4 letters, but I'll use English for explaination.
    A SNP is a single letter which has different values in different individuals: "The cat and the dog" vs "the hat and the dog".
    An indel is where letters have been inserted into one sequence or deleted from another (without additional data, we can't distinguish these possibilities.)
    "The cat and the dog" vs "the cat and the big dog".
    In alternate alleles there are a bunch of changes which always stick together, e.g. we observe "the cat and the big dog" and "the cat and the small mouse", but never (or exceedingly rarely) "the cat and the big mouse" or "the cat and the small dog."
    Variable repeats are a special case of indels, but common enough to warrant a category of their own. "The cat and and and the dog" vs "the cat and and and and and the dog".

  • protein modelling (Score:3, Insightful)

    by sc0p3 (972992) <{jaredbroad} {at} {gmail.com}> on Wednesday May 17 2006, @08:43PM (#15355517) Homepage Journal
    This is good news but not too useful until we can model protein shaping.

    The AGCT's code for proteins and so far we can only model very short combinations. All you coders keen for a life project have a crack at it. Theres 20 amino acids formed from combinations of three base pairs. The amino acids have attraction and repulsion properties with each other and their environment and form to make a unique shape. Its the analysis of that 3D shape that will solve:

    - all cancer - modelling protein shapes means instant cancer cures
    - bird flu - again modelling proteins means instant antibodies to diseases
    - the most toxic substance ever invented - it will also open up designer drugs
  • by Anonymous Coward on Wednesday May 17 2006, @08:44PM (#15355524)
    gtcatgcgatacgtaggcaaatcg2tgacggcagt

    hmmm i guess its not as funny unless its binary
  • by jerometremblay (513886) on Wednesday May 17 2006, @09:01PM (#15355605) Homepage
    How do they differentiate junk dna from genes?

    I undestand that even if they don't know what a gene is doing, they can single it out from the rest of the dna. How do they do that?

    What makes a gene a gene?
    • In addition to what's already been mentioned, there are some highly characteristic start sequences "upstream" from the actual coding sequence, including what's called a "TATA box", a sequence of about eight nucleotides, where the most preserved part is TATA. The individual nucleotides vary a little, but it's still quite detectable in the overall noise.

      In addition, we have other effects. For example, there is a varying stability between GC and AT pairs, which gives a tendency to a biased ratio in "junk". Th

  • 3,141 genes? (Score:3, Interesting)

    by SashaM (520334) <[moc.liamg] [ta] [ahsasm]> on Thursday May 18 2006, @04:54AM (#15356128) Homepage
    Did anyone else find the number 3,141 [google.com] interesting? Is that a coincidence, or is there a good reason?
    • Yea, especially since you have exactly 3,141.59... genes.

      And the distance from the base of the Great Pyramid is exactly twice the distance times 3/23 - the number of pounds in a dozen African Eliphants minus the sum of them... ... you get 666! Therefore, your genes are the antichrist. We should change public policy to better fit with this.
  • Finished my ass (Score:4, Interesting)

    by pugdk (697845) on Thursday May 18 2006, @06:33AM (#15356384) Homepage
    There are still large gaps in each chromosome, either due to repetitive sequences, high GC content or closeness to the centromere - basically saying that the human genome is finally done is like saying that 99.9% equals 100%, which it doesn't. This is especially important in cases where you actually NEED to use sequence in areas where it has not been assembled correctly or has not been sequenced... which has happend to me multiple times during the last couple of years... oh and those places in the genome have been unfinished ever since the first installment appeared publicly... they are even lacking in the Celera version of the genome... Finished my ass! -pug
  • by ill dillettante (658149) on Thursday May 18 2006, @06:51AM (#15356444) Homepage
    It is actually only about 75% complete - basically the scientist involved have no idea how to finish the remaining sections (mostly simple repeats) so they have "defined" the genome complete by saying that these regions are unimportant.

    This is by my count the fourth time that the human genome has been announced "finished" - anymore times and they will all be invited to become slashdot editors.

    • I'm forced to agree with QuantumG. I'm a Human Geneticist and the genome project is an invaluable tool in the study of human disease. I can understand the fear of the misuse of the technology, but do you think that part of the genome should have been left unsequenced? If so which parts? What would be the benefit of such and action? This technology has allowed for the development of the ability to rapidly screen for the many know disease mutations to assess risk for "genetic" disease. It has also had practi
        • The basic idea is this. Our cells need a program that tells them what to do. That's the genome. There are a total of 46 chromosomes consisting of two sets of 23 independent chromosomes (1 - 22 and X or Y). DNA makes up the chromsomes. It's just a chemical structure that stores information; the four chemicals that make up DNA are Adenine (A), Thymidine (T), Cytosine (C) and Guanine (G). Every DNA molecule is actually two pieces of DNA that pair together as A binding to T and C binding to G. Sequencing is a c
          • I have questions also, if you'll indulge me:

            When we say that "the gene for xxxx is located at yyyy

            This means that we *do* know where the particular controlling sequence is located?

            Viral gene therapy is a process that can locate the target gene somehow and replace the sequence there with a new sequence?

            Does the sequence have to be broken, segmented, and re-built for viral gene therapy? Or is there a "merge" type of operation that "overlays" the new information?

            I have read a great deal that in a han

    • Re:3,141 genes (Score:5, Informative)

      by pchan- (118053) on Wednesday May 17 2006, @09:01PM (#15355601) Journal
      You seem to be under the impression that the number 1000 has some special meaning. Let's try your comment again, in octal:

      pi * 1750 genes. Got to love those fun coincidences

      Not so exciting now, is it? Nature is not decimal-based. The only reason we tend to be is because of the number of fingers we have.
      • Indeed, and the number of fingers we have is specified in the genes, so maybe it's not a coincidence after all?
      • Re:3,141 genes (Score:5, Interesting)

        by Opportunist (166417) on Thursday May 18 2006, @06:07AM (#15356300)
        Actually there are a few "numbers" that are "magic" in nature. Depending on the species.

        10 certainly is important to us, having 10 fingers and 10 toes. Unless you're carpenter.
        Asking a bee, you'd prolly be called crazy and 6 is the perfect number, from legs to comb.
        A spider would probably tell you 8 is more important, from legs to their web's segments.

        But since this genome has meaning for us, I'd wager that our "magic" applies.
    • Completing the sequence and actually putting it together are two entirely different affairs. Small sequences called ESTs (Expressed Sequence Tags) were obtained during this effort. The big task after that was to put everything together AND in order. Think of it as a massive puzzle. Even the genome has different "builds" depending on the level of completeness of this work.
      • Blacks were bred to have more physical ability by slave owners, much like dog breeds were bred to encourage certain traits. There is no gene for it and these qualities will in fact recede over time.

        You do realize that breeding like to like is genetic manipulation? That what you are essentially doing is reinforcing genes that express the desirous trait and eliminating genes that don't? Physical ability may have been bred in to certain people, as you suggest, and it may recede over time, but it's still a g