Stories
Slash Boxes
Comments
Search

News for nerds, stuff that matters

Slashdot Log In

Log In

Create Account  |  Retrieve Password

Celera Opens Up DNA Database

Posted by timothy on Sat Apr 30, 2005 08:23 PM
from the time-to-meet-the-ceo dept.
Biotech Science
greenplato writes "Thirty billion base pairs from the sequences of humans, mice, and rats that were available only by subscription to Celera's DNA database are being put into the public domain. Celera will donate this information to a 'federally run database,' presumably GenBank. Francis Collins, head of the National Human Genome Research Institute, notes that 'data just wants to be public.' Stories in BusinessWeek and The New York Times."
+ -
story
This discussion has been archived. No new comments can be posted.
The Fine Print: The following comments are owned by whoever posted them. We are not responsible for them in any way.

Celera Opens Up DNA Database 50 Comments More /

 Full
 Abbreviated
 Hidden
More
Loading... please wait.

  • Shouldn't that be (Score:5, Insightful)

    by Spetiam (671180) on Saturday April 30 2005, @08:26PM (#12395365) Journal
    Shouldn't that be "data want to be free?" :)
    • Or actually, I was thinking something more along the lines of, "All your DNA are belong to us."
    • Shouldn't that be "data want to be free?" :)

      Okay, it's probably just me but when I read that I had a vision of Brent Spiner rattling the bars of a cage yelling "Picard, get your bald ass down here, Data want to be free!"

    • The problem is, the researchers spent too much time studying the "free as in beer" part, and were much too drunk. Besides, they didn't feel like inscribing the GPL into just four base pairs.

      (On the flip-side, this is excellent news. Researchers have a long history of putting things in the public domain - they have been the main driving force behind the idea - and it is most excellent that commercial researchers are beginning to realize that this isn't purely by chance.)

  • from the summary (Score:5, Funny)

    by Anonymous Coward on Saturday April 30 2005, @08:33PM (#12395405)
    Francis Collins, head of the National Human Genome Research Institute, notes that 'data just wants to be public.'

    Data hates when you anthropomorphize it.

  • I don't think it wants to be free. (Score:3, Insightful)

    by chriswaclawik (859112) on Saturday April 30 2005, @08:39PM (#12395446)
    Considering the millions of dollars that Celera invested in gene sequencing, it should at least have the opportunity to make back that money. Heaven forbid, they might even deserve to make a PROFIT. Profit is a leading motivation of many corporations, you know...

    • Considering the millions of dollars that Celera invested in gene sequencing, it should at least have the opportunity to make back that money.

      If he were creating something new then perhaps, but it was just a land grab. The DNA was there and they tried to patent as much of it as possible. It reminds me of the Eddie Izzard skit when the Europeans claim America and the Indians say, "but it's here, you know, we're using it, how can it be yours?" And the Europeans say, "but ah, have you got a flag?"

      Replace flag with patent. You might as well say that the Spaniards spent a lot of money colonizing Peru so they deserved all the gold. This is DNA! It belongs to no individual or corporation. I want access to my source code for whatever purposes I choose.

  • Oh No! (Score:5, Funny)

    by Anonymous Coward on Saturday April 30 2005, @08:41PM (#12395453)
    They've open sourced me! Does this mean I have to call myself GNU/Steve?

  • What about patents? (Score:3, Insightful)

    by Krankheit (830769) on Saturday April 30 2005, @08:41PM (#12395454)
    Hasn't much of the human genome been patented by greedy companies?
    • Hasn't much of the human genome been patented by greedy companies?

      In a word, no.

      You can't generally patent "found" sequences. You have to create or assemble something novel. The raw sequence of the human genome is not patentable. Inserting novel or transgenic genes into the human genome might be, but that's still science fiction.

      • Re:What about patents? (Score:5, Insightful)

        by the gnat (153162) on Saturday April 30 2005, @11:07PM (#12396147)
        You can't generally patent "found" sequences.

        I wish that were not the case. However, there are many gene patents in existence. The trick is that now you have to show a function for that gene - although bioinformatics is sophisticated (or rather, automated) enough that you can come up with a plausible-sounding function without ever doing benchwork.

        What's really being patented is the medical application of these sequences. For instance, Company X discovers that gene Y is overexpressed in cancer Z. They take out a patent on gene Y based on this discovery. That means that no one else can pursue gene Y as a therapeutic target. Moreover, in one case testing for a specific mutation to detect cancer was covered by a patent. This is a very simple piece of labwork being covered, which any competent cancer researcher could have figured out.

        The end result is that patents are being awarded for hard work, not for novelty and invention. Throw enough money at a subject, and you'll get data but not necessarily results. Since companies (or academics) can now patent just the data, if someone else gets "lucky" and comes up with an actual result the patent holders can sue the tar out of them if they try to make money off it. (Or even if they don't, as in the case of the breast cancer gene; the company wanted people to pay three times as much for its own testing kit.)

        You may soon be able to patent single-nucleotide polymorphisms (SNPs), which may be involved in differential drug responses. Back when I was in college we had a guest lecturer who was a biotech patent attorney, and he said he though SNPs should definitely be patentable. In any case, there is a world of difference between patenting a cancer drug, and patenting a gene (or a FUCKING POINT MUTATION) that may, in the future, be a drug target.

        Since most of the human genome is noncoding, I suspect it will be harder to patent pieces of it. I also suspect that some asshole will try anyway.

  • Again? (Score:5, Insightful)

    by zappepcs (820751) on Saturday April 30 2005, @08:44PM (#12395474) Journal
    FTA "DNA database are being put into the public domain" Again, we find information and data that SHOULD be in the public domain, yet the patent office, government, and kickbacks protect those that stand to make money? Its time that we, as a populace, stand and shout for the rights of the public to information. Sure, there are those that say that without protection, such innovation would be stiffled, and I counter with this... "should such efforts be in the public sector?" Through emminent domain, they can take your property, but if you are a business, there seems to be no such thing. I hear of companies giving to this charity or that... but none are giving to the charity of mankind? Information is power, and in this information age, it is time for those with the information to take power from those that would use it to extort finance and power from those that do not know better. All such information should be in the public domain. Knowledge of the human genome, of anything that affects ALL of us, should be public information. For instance, any method of retrieving emergency information during an emergency should be in the public domain, not a subject of patent worthiness. The entire point of 911 service is to aid the community, not bilk them of dollars. The entire point of scientific discovery is to learn and advance humankind... when it becomes simply a method of making money, the advancement of humankind goes in the trash like yesterdays junk mail. At that point, what is the point of funding science? Think bigger than your new BMW. This might seem altruistic, but what is the point of discovery if your only reason to share is profit? When do you lose respect, when do you stop having authority? The ONLY method of advancing the human race is through sharing, through communal discovery. Perhaps this will advance that purpose, perhaps it won't.

    • Re:Again? (Score:4, Insightful)

      by Saeed al-Sahaf (665390) on Saturday April 30 2005, @09:20PM (#12395649) Homepage
      Yes, yes, yes... But who is going to fund all this discovery? If it's "the public", than of course "the public" should be able to access it (although I don't think most of us could make much use of it), but if on the other hand it is some private concern that is doing the research, than they have every right to obtain value from their investment. That they are being put into the public domain is a great thing for Celera to do. If they want something out of it, I see no problem with that, I'm sure they spent a lot of $$$ to do the work.
      • It's kinda hard, isn't it?

        I think that on these things, companies should be given limited access - perhaps for a few years, so that they can capitalize on their investment. After about 5 years or so, they'd better make it public domain.

        Ofcourse, in that case, companies will wait for a good while before making it public that they indeed do have the data.
        • I think that on these things, companies should be given limited access - perhaps for a few years, so that they can capitalize on their investment. After about 5 years or so, they'd better make it public domain.

          Great idea, isn't it? It's called "patents", and they have thought of it a while ago. The problem is mostly with the current implementation.

      • I take it that you, honestly, believe and trust in pharmacuetical companies? Information is power and anything that affects all of us should and needs to be available to all, and not simply in the hands of the government and patent office. When you are informed enough to know if a new drug is harmful, and no longer need to listend to weight loss advertisements because you listened to another group who has access to the information and knows different... well, your argument falls flat right there... who do y
      • Yup. If the parent wants the data to be free then eh can pay for it or do it himself. Thsi was a purely private effort and has every right to keep the data private.
        And there WAS a public project to sequence the human genome which did rather well. If you want the data to be public then the public has to pay for it, or have some altruistic individual pay for it. Can't get something for nothing.
        The parent really should keep the following in mind: if the data wasn't private then there would be no Celera data (s

  • Curious (Score:4, Interesting)

    by Sparr0 (451780) <sparr0NO@SPAMgmail.com> on Saturday April 30 2005, @08:48PM (#12395500) Homepage Journal
    I wonder why something like this isnt inherently unprotectable, like the contents of the phone book. A DNA sequence is, after all, simply a record of an existing state of things, NOT an original work (barring genetic engineering, which this isnt). If I take your phonenumber/basepair book and reproduce it... have I broken any laws (apparently the answers are no and yes, in that order)? The precedent for this has existed for decades.
    • Copyright has never protected ideas, only expressions of an idea in a fixed medium. So, yes, a phone book can be granted copyright protection but the phone numbers themselves cannot be copyrighted since they are not original ideas. Gene sequences may not be granted copyright protection (they can be patented in the US), but the database and the way it presents this information can be granted protection. The important thing to remember, and why reading any discussion about copyright on Slashdot is extremel
      • Yes, but the expression of an idea that is a movie also effectively copyrights the idea, because any future expressions of that same idea can be argued to be derivative works of the original movie. However, this same extension has been held to NOT apply to phone books, where the secondary works are most definitely derivatives of the original (insofar as the idea (database) only exists publically in the form of the particular original expression).
    • > I wonder why something like this isnt inherently
      > unprotectable

      The data itself was never protected in any way: you've always been free to read your own DNA. The database that Celera owned was protected as a trade secret. You could only look at it after signing a contract in which you agreed not to disclose what you saw.
      • The database that Celera owned was protected as a trade secret.

        And under copyright. Anyone else is free to duplicate a private genome database if they're willing to spend millions of dollars on sequencing. However, you couldn't take someone else's proprietary database and redistribute it. I assume the trade secrets were any specific annotations that Celera had made - for instance, you couldn't subscribe and then start blabbing about their annotations, or re-annotating the public database based on their

  • Free data - or unable to sell it? (Score:5, Interesting)

    by Anonymous Coward on Saturday April 30 2005, @08:51PM (#12395513)

    I work for a biotech company with a database which we've been trying to sell subscriptions to for a few years. The prevailing experience with trying to sell the database is that people are very reluctant to shell out the cash to access the data.

    I think this is a symptom of trying to sell data to academic institutions. The problems with selling to academic institutions are two-fold; Firstly the universities don't have the cold hard cash to spend on the databases, so any cost over free is too expensive. Secondly, there is the free/open culture within universities that almost punishes commercial ventures for trying to build a business around adding some kind of value to the data (such as convenience or quality of data).

    Because of the lack of sales for this database, we're considering handing the data over to a large government body so that they can maintain it, because the company can't simply afford to maintain the database - it costs a lot of money to hire talented people to do database curation.

    So when Celera say that "data wants to be free", I think they mean "We'd sell you this data to try and recoup our investment, but we're resigned to the fact that you're not going to buy it".

    • Re:Free data - or unable to sell it? (Score:5, Informative)

      by the gnat (153162) on Saturday April 30 2005, @11:21PM (#12396218)
      Secondly, there is the free/open culture within universities that almost punishes commercial ventures

      I would not have stated it that way. The real reason is that academics hate to leave anything unpublished. If they're constrained by copyright law or some NDA, they can't tell everyone about the fabulous new work they've been doing - or at the very least, it becomes much more difficult.

      I worked in bioinformatics at a university for several years, and much of what we did was take existing databases and analyze them, then publish the results online as our own database of annotations. As part of this, we reproduced much of the original database in modified form - and all we had to do was cite the original authors and describe our methods/sources. If the databases we used had not been public, none of these projects would have happened. In some cases, we had to ignore private databases that we had limited access to because we were not allowed to reproduce any of their data.

      This is only cultural to the extent that academia thrives on publications. We're not out to punish anyone from trying to make an honest buck (lots of people here collaborate with or consult for companies), but we literally can't afford, professionally, to limit ourselves in accordance with restrictions on databases. So why pay money for something we can't legally use in the manner to which we're accustomed?
  • Sure the public can view the DNA but did Celera surrender the patents too??

  • Finally... (Score:2, Interesting)

    by nxtr (813179)
    Now what do I do with it?

  • Some stuff you just can't sell (Score:3)

    by MillionthMonkey (240664) on Saturday April 30 2005, @09:13PM (#12395616)
    I hear what you're saying about academic institutions. They're incredibly whiny and expect everything to be free. We make very little money off of them, and they consume a large share of tech support, but we go out of our way to be nice to them because many of the same people later pop up in pharmaceutical companies in control of large quantities of cash.

    Celera saw the writing on the wall. Everyone is using the public reference assembly because it's free, and in terms of contents the two are merging toward a complete consensus as they approach total coverage. You can only make money selling this kind of information while vast portions of the genome remain unknown or unavailable, and that's not true anymore.

    Plus using a different assembly than other researchers cuts you off. When we import data from dbSNP, for example, we regularly drop references to positions specified in reference to Celera contigs. (Not much of a problem, since they're in the vast minority.) The Celera assembly has not been freely downloadable and redistributable, and we haven't been including a copy of it in our software (we always include a current public assembly build). Now that this has happened, I think the next build of the public assembly is going to be really good.

  • The human genome project (Score:4, Interesting)

    by $exyNerdie (683214) on Saturday April 30 2005, @09:29PM (#12395695) Homepage Journal

    Excellent PBS video on race between government and Celera to crack the human genome:

    http://www.pbs.org/wgbh/nova/genome/program.html [pbs.org]

    Mirrors please..

  • or he'll write a bill preventing the data from being released.

    Oh wait, there's no corporation for him to whore himself out to. Maybe this will actually see daylight.

  • In case it gets slashdotted.... (Score:5, Funny)

    by MagicDude (727944) on Saturday April 30 2005, @10:11PM (#12395905)
    Here's a copy of the data

    acgcggcgatgcgtacatagctagcgctgcatagatcgactatgacgatt atgactgatcggtagcatatattatgctatagctagcgtgtagctagtat cacatcagctactatgtagctacgatcgagcacactgactacgtagctag tagcggatcgatagctgatctgactgactatatatagcgcgcgatatata gcgcgtagatcgtagccgcgcgatgatatataaggagactgactagc...

    • Re:In case it gets slashdotted.... (Score:4, Informative)

      by jcomand (648678) on Sunday May 01 2005, @07:24AM (#12397469)
      Good guess, but only part of that sequence is actually in the human genome, in chromosome 20 (with one error):
      Query: 103 catcagctactatgtagctacgatc 127
      Sbjct: 84163 catcagctactttgtagctacgatc 84187
      The quality of match is rated at E=0.65, which means that you would expect to find a match this good by chance 65% of the time. (E value will change slightly if you search different databases.)
      Try searching for the sequence yourself here under Nucleotide-nucleotide BLAST (blastn) [nih.gov]

      If you want to see the real thing, you can browse one version of the "real" human genome here [nih.gov]. If you click on the blue chromosome 1, and then "Download/View Sequence/Evidence", then "display", you can see the repeating "telomere" sequence at the beginning of chromosome 1.
  • Does anyone remember the story of the hacker that actually wrote the code that cracked the genome sequencing problem? He is the unsung hero of this whole private vs. public debacle. He wrote a 10,000 line C program to do the sequencing in "rafts" and "contigs" in the space of a few days -- and had to ice his wrists from all the work... it was because of his brilliant work that the race went from being a 20-year thing to a 3-year thing, and of course nobody knows his name. (And I've forgotten it.)

  • Well this is a bit embarrassing (Score:5, Insightful)

    by glwtta (532858) on Saturday April 30 2005, @10:39PM (#12396040) Homepage
    I supposedly do this crap for a living, and I find out about this from slashdot.

    Anyway, Celera seems to epitomize the way large projects like this become free: they sink billions upon billions of dollars into a project which is soon supplanted by a better free (though, of course, government funded) alternative, and after years of unsuccessfully trying to sell it, release it for free for a bit of good PR.

    But then again, they've made a huge contribution to the field overall; Craig Venter may be an arrogant prick, but he gets shit done, while Francis Collins mostly waxes poetic about the bright future of genomics.

    Well, that seems like enough venting about the sad state of research.

  • 30 Billion Base Pairs (Score:3, Insightful)

    by Sentriculus (880382) on Sunday May 01 2005, @12:10AM (#12396405)
    Someone has probably already pointed out that human DNA contains 3 billion base pairs and not 30 billion. It is a sad shame that a company as renown as Celera is overshadowed by blatant misinformation; even from former CEO Craig Venter who is known for calling archea a type of bacteria in the December 2004 issue of SCIENCE magazine. Mishaps like this further alienate the real intellectuals who would normally be capable of over-running the Internet towards an information rapture in the scientific community.

    -Bio major/Nerd

  • It's already free (Score:5, Informative)

    by jezmund (102188) on Sunday May 01 2005, @01:57AM (#12396756) Homepage
    Genomes are available at [ensembl.org] http://www.ensembl.org/ [ensembl.org] . I know I've said this before, but I feel it can't be overemphasized. Ensembl is so incredibly cool. I imagine Celera is releasing their data because no one wants to pay for it when Ensembl has it for free. Additionally, Ensembl has tools that provide so much more than just genome sequence-scanning. And they use open source projects like BioPerl and use Wiki for documentation! I think this is just a PR stunt for Celera.

    • Re:'Bout Time (Score:4, Insightful)

      by Seoulstriker (748895) on Saturday April 30 2005, @08:38PM (#12395438)
      That is so wrong on numerous levels. Hi Evil Corporation, here's ten thousand dollars so I can get a peek at genetic code that I inherently share with every human being in the first place.

      Let's see, the one company that pioneered genome research with reliable and extremely efficient shotgun sequencing, is now an evil corporation because it wanted to use its investments in research for developing novel therapeutics. Which in the end benefits human-kind. Please...
      • Celera is pretty evil as a employer. At one time the company had an insane stock evaluation. They realised that the genome database profits will end soon and the "synergies" with its own drug research will not happen. So they fired the genome people and used the stock proceeds to buy up biologic instrument companies and some small biotech companies. Making instruments and biology tools is what produces any income for them.

        I worked for a small biotech company that became a part of Celera. They are doing a g

        • Re:'Bout Time (Score:4, Insightful)

          by Fnkmaster (89084) on Saturday April 30 2005, @11:28PM (#12396242)
          So, lemme get this straight: they fired the people in an unprofitable part of their business and expanded into profitable endeavours. God, that sounds absolutely evil. Err... maybe that's just basic sound business practice?

          Upper management may or may not be rotten, but you don't really explain what was "evil" about their actions.
          • No, just the general treatment of people. I am so happy to be out of there. I got Dilbertized there and the way they fired me when the management learned that I leaving was just nice example of corporate nastiness. How they dealt with people in their Maryland site which got summarily closed down after squeezed all the dought for Celera from them just seems to fit my experience.
      • Celera's "exremely efficient" method only worked because the NIH's freely available genome data was available. Without it Celera's "shotgun" fragments would have been just that - fragments. It took a base of comparison to complete the map.

        Celera relied on the "free research" of the NIH. They extended that research with their own technique, and then patented the result of the joint data.
        • Celera relied on the "free research" of the NIH. They extended that research with their own technique, and then patented the result of the joint data.

          Fixed: Car companies rely on the "free roads" of the federal government. They extend that infrustructure with their own cars, and then profit off the result of the joint use.

          How evil of them!

    • IIRC from so many years back, it was the CEO's own genome that was sequenced by Celera (who went by a different name back then, I think.) So in at least that sense, he holds the copyright and is entitled to sell subscriptions.
    • Then go and have fun reading yoru DNA. Keep in mind that if they couldn't make money from it then they would have never sequenced it so either way you don't see it, why complain?
    • The data was publicly available from Genbank or the public sequencing effort. Heck I can go to about 2 or 3 websites right now and get it.
      Celera's advantage was/is that the data was of higher quality and their database was curated better and had a higher reliability.
      Now the public databases have become good enough that you don't need to use Celera's tools. I still find that the public databases are a bit of a mess but they are good enough to get the job done.
        • Both sides had a difficult time assembling the sequence. Celera's data was of higher quality because their method provided for better coverage AND they could use the public data to clear up any ambiguities.

All trademarks and copyrights on this page are owned by their respective owners. Comments are owned by the Poster. The Rest © 1997-2009 Geeknet, Inc.